--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (38939 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (15 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1241       1331   0    Initial     91    54    Marginal
tgcgaggcggtcccgctctccccacccctcagcccgcgcccggcggagagactacaactc
ccggagtgctctgggaacggagccacgggagctacaggcggagggacccgagggcgggct
ttccgggtgtgtgtttccggcgtcggcggccgcggccggggacggtgtgagagcggtaag
ATGGCGGCGGCGGCGGTGGTGGAGTTCCAGAGAGCCCAGTCTCTACTCAGCACCGACCGG
GAGGCCTCCATCGACATCCTCCACTCCATCG
gtaaaggtcgccgcgccgcctccccggccccgccggcccagctcggcttatgtcggtcgg
cggcagcggagaggggcccggctagccggctctgatgctgctgactcactgtgtgagggg
ggccgggccgggggcgcaggccgctcggagctccccagagcctcccaggtctcactcttg

Exon  2 +       3662       3823   1   Internal    162   100   Excellent
ttctacgtatatatgatcttttttttttcctggcttagagttttttttttttttttaact
ctagaatttgtcttttggtaaatatgtttgagtttgtaatggatcttatgagggtgaaat
ttccctcagtcttcattttttggtcagaattttaagagggtttgcattttcctctcccag
TGAAGCGTGACATTCAGGAAAACGATGAAGAGGCAGTGCAAGTCAAAGAGCAGAGCATCC
TGGAACTGGGATCTCTCCTGGCAAAGACTGGACAAGCTGCAGGTAAGTGCTACACATGGA
TTGTATCTGAAATGCTCAGTGAAATTCCTGTCTTTTGTTGGA
gtgaagaatcatgggactgatccacaaactgaattcagctttattttcttggcaacttgt
tgagcttcagttttttagcaggcaattaagtggcctttaaactcacttctttcctggtag
tttagttttgcaaatgagagacaatcttatttttgttgggatatagtgatttctgatttg

Exon  3 +       4177       4197   0   Terminal     21    52    Marginal
tgatttgtttctggtttttgaattctcactgtattcccttacatagaggcagcaacagtc
ttcaataatttcactgagcaactctgatgtatttaagatagataacaactttaagcgcct
gatttaaaaatgacaaaggattttgtatccaagtgactcactgtcatttttttttgatag
ATTCAGAATGAGAATGAATAA
gacattaaatggagccttcccaagacttctgcattcatacctaggactttgtgcacatca
ttgctcaaacattctagttgtaattgaaccattgactgattagatttgacataatattct
gatgatgggtgtgtccttggaatgagaagggagtccttttgatcaggaaggaccttttac

Exon  4 +      11212      11336   1   Internal    125   100   Excellent
ttaacttatttttgctattctgctatttgctaggaatgctttaaactcctagtaagtttc
acttagactgattccagtgatgtaagtaccgatttttatgacgttgggtcagtttcttaa
gtgggtattttgtctcaaatgttgatgtttactcctctttttgaattgcctttcctacag
AGCTTGGAGGACTCCTGAAGTATGTACGACCCTTCTTGAATTCCATCAGCAAGGCTAAAG
CAGCTCGCCTGGTCCGATCTCTTCTTGATCTGTTTCTTGATATGGAAGCAGCTACAGGGC
AGGAG
gtaagtgatattaatgacagaaagtagacaatatggagaaaagtttgtttccaagaaaga
aatgcctacctgcactttagtactaatgtggaagggaaaactgggaggacagcgcaggac
ttatcatgtcagtttctctttgttacagggcatttgatactttgggtctgttccatgctt

Exon  5 +      18641      18755   0    Initial    115    47    Marginal
agcagatatatgtgatagtccagatattaaccgattagtagtccttaggtgaattcatct
tatacaattgtgatatagcttgcttttattttagtttttcgttctgtcttatttttagaa
aatttttatgaggtcagttgagtttagagttggagattaggtagccaccagggggctcca
ATGAGGAGTTACAAAGGTTTTGCTGGTTCTCTTACTGGCAAATCCTCTGATGTTACCCGT
CAGTTCACCTTAGGTGAATCACTTAGTGTCTGGACTATCAGGGAAATGGAGGCAG
gtgaattgcaggagtataattcattgtttcttaattagagatatactttcaatgaccaag
ctctattctagactaatgaatcaacagcccaggcattctttttttttggtagatgagtgt
ggtaaatggtttattgaaataaaacttacagaggaatatttctaagtcctaggtattcat

Exon  6 +      20735      20837   0    Initial    103    69    Marginal
taatctaagcacaaaaatattttatgtgtaaaaagccaagttgatgctccattatgatat
aactattacacattgagatactgtggatcagacactaaatagagcaacatggataatatg
taaggagggaatttaagctgttctccaaagcatggtttgtgggaagaatttgaggacata
ATGTTGCATGTACTGTCTCTCCTTATTGCAGGTCGAGCTGTGTTTAGAGTGCATCGAATG
GGCCAAGTCAGAGAAAAGAACTTTCTTACGCCAAGCTTTGGAG
gtaggttttacattagtactcatttcaggtctctaagcatgagacagagggtgaatgtaa
gcagtaccatccttatcaaaagtatcttcagcaactttgtaattacctagataccgaaag
attattgatggtagccccacttatgataattgctctgattgaagttttgagacagatttg

Exon  7 +      21238      21295   0   Internal     58    98   Excellent
aacagtcatttgctggctataataggagacaatacattggctagatcgtctcttatgctg
aatttgatgctatcatcagaaattgcatatttaacagtaacagttctgtgactgtcaatc
tttgatttctttctgtggctttttccccccccttcaatcaatgccttttctctttcctag
GCAAGACTGGTGTCTTTGTACTTTGATACCAAGAGGTACCAGGAAGCATTGCATTTGG
gtaagtaagctggtaataagtcatctcagctagctaaatgaatgtattctaaaccacctg
gctactcttactaattacctgttaataatttatattctactgacttctaagaaggattta
aagtagcttacagttctgcatttgtcatgggaaaatgtcatttgaaagtttaaaaaacta

Exon  8 +      25716      25910   1   Internal    195   100   Excellent
ctcttggaagatagcacattagtggaaaatttaattattgcatggggtctagaggtaacc
ttttttgagttcaggaatttttttttttttttaatcctgagtgttatgagggtgggagag
tgagctattattaggtattaagctgatggctataaaggagaatgtcttttcctttttcag
GTTCTCAGCTGCTGCGGGAGTTGAAAAAGATGGACGACAAAGCTCTTTTGGTGGAAGTAC
AGCTTTTAGAAAGCAAAACATACCATGCCCTGAGCAACCTGCCGAAAGCCCGAGCTGCCT
TAACTTCTGCTCGAACCACAGCAAATGCCATCTACTGCCCCCCTAAATTGCAGGCCACCT
TGGACATGCAGTCGG
gtaacagacgtagctattcctgggatgtgttttcttaaagctcatcttattttataggtg
gaaggaatgggggttggggctggagaataaaattggctgatttggctctagcttcttcag
agaaccagttagaaagctacctttctaactagctgctcccctcctgttaactgcctaaaa

Exon  9 +      30518      30662   1   Internal    145   100   Excellent
ctcaggcttgtctcgaactcctgggctcacatgatcctcccatctcagcctcccaaagtg
tggatttacaggtgtgagccaccgtgcccatttaggtagatgtctaagctgcctcccagc
tctgatcttttatggctctattattttatatgttcttattcctttcttttcaatgcccag
GTATTATCCATGCAGCAGAAGAGAAGGACTGGAAAACTGCGTACTCATACTTCTATGAGG
CATTTGAGGGTTATGACTCCATCGACAGCCCCAAGGCCATCACATCTCTGAAGTACATGT
TGCTGTGCAAAATCATGCTCAACAC
gtaggtgcaccttaactctggactacaagaactcagatccttcagcaagtctgtttgcca
tggcagagatggcctgagcagggagtttggccagttacagaaacagcagcagctgcggcc
tctagggctggctaaggtagagcgggaggatcaaaagtggtccagaaaactttcgcttgc

Exon 10 +      31481      31541   2   Internal     61    82        Good
cagagtggagaaaacctagcttttgcaatgtgatgggcatatgggtttaggggttgggct
gattgtctgtgtgggcagagtctttattacaatggaattctgttaaaaagaaatttgccc
aaaccttcctttagaagcataacatctgcagcaattgaccaagtatgtctttttttctag
CCCAGAAGATGTCCAGGCTTTGGTGAGCGGGAAGCTTGCACTTCGGTATGCAGGGAGGCA
G
gtagggactcccttgactgcagttctgctcactctgagaccagcatgttttcagagtcac
aacgtttgatgagaccagcactcttcagatcttcatactactctcttccttctgccccac
tcacttccttcccttaagcccattcagtgtgtttcccagactgttaaattcttggcctgg

Exon 11 +      34238      34300   0   Internal     63   100   Excellent
ggcatatagtggtattcagtacttgcggctcttcttcccgggcgtctgaagaagaacgat
ggtggggcgggttcttccttttggcagaagttgtgtggacacagcatactgcttatgaga
cttgggtaaatgttagtgtgcagaataaatcgctttcatggtttgtctctttattctcag
ACAGAAGCATTAAAATGCGTGGCTCAGGCTAGCAAGAACAGATCACTGGCAGATTTTGAA
AAG
gtgagtatgatattgggttggtatggaatgtgagtggaagagagggacgtttaagtactt
caaaacacacttttaaaaataattatagtttcaaaagaagttgcaaatgattccatgtat
ccttcacctaggacagtattaaaaccaggaaatagttaagcactttgtacaatgaaactt

Exon 12 +      35968      36093   0   Internal    126   100   Excellent
aacttccctttcagttcttgacattccttttctgctttgtatcatgcatctccccagatc
tcccctaacttcattcaaccatgtagttttataagggccagcagactatctaggaagcag
gagtagcatgactttaaagtgattctctgtgccaatctctgcaactggttcctttggcag
GCTCTGACAGATTACCGGGCAGAGCTCCGGGATGACCCAATCATCAGCACACACTTGGCC
AAGTTGTATGATAACTTACTAGAACAGAATCTGATCCGAGTCATTGAGCCTTTTTCCAGA
GTACAG
gtgagaaccctctggggactccatttctggccaggcattctcactgtagccacctccctt
ccacacctgtccagaatgggaactcacttctaggggtgtgcctggtgggcaagaggccac
caagagcttgggcctctgttgataaaatgaacaaaaatcgaggagagagatgctgtgggt

Exon 13 +      36863      36914   0   Internal     52   100   Excellent
cattggaaagctccccagcttctcagtggggaatgggcagtgtggactagagtaggagtt
gcattgttgctattttgttttcagtccatttggcctaagacccctccaacaaagctactg
tgtcagggtgatctctgactagtggatactggtccctttaatcatgtgctttgattttag
GCCGACGTGGAAAGGAAATTATCACAGATGATTCTTGACAAGAAATTTCATG
gtaagtaacagtcacacaggcaagggggctggtggtggtgatgagatggttgaagaagtt
tattttcaaagaagatgttctatttgtttcccccgatggttcaccctggggtcctggccc
ctcttccctgtgatgagaatgtgtaataagcatgtgtacatggaatagggagatgaattc

Exon 14 +      37206      37348   1   Terminal    143    89        Good
tcctggcccctcttccctgtgatgagaatgtgtaataagcatgtgtacatggaataggga
gatgaattctatttcccttcttttctggacacagtgagtcaactagggagtgggctgctt
cacaaacacttttgtgtctaacctcatcttttacctgggttgcccttgtgtttcttgcag
GGATTTTGGACCAGGGGGAGGGTGTCCTGATTATTTTCGATGAACCCCCAGTAGATAAAA
CTTACGAAGCTGCTCTGGAAACAATTCAGAACATGAGCAAAGTAGTGGATTCCCTCTACA
ACAAAGCCAAGAAACTGACATAG
gtgagtgctggcttcaggaccccagggctgggcagctctgtcttctgcgtgtcgagactg
aaaacctcctcctggtgtcctcatggcttcctgattgacactgctctgtcttctcttgca
gagttggatctgtagcggtcctttggagagtgtgtgtggcgggagagtgaaaccttgggg

Exon 15 +      38636      38699   0    Initial     64    76        Good
tcagatggatttattccttttttaaacaatgaacatcggaaatgagactgtggggtgtgg
tttctctctctcttttttttttaattttctttgttgggtttttgagcaacctcatgtccc
cttcccagggagctttttaatttacctcttagaactcaagtggatgggaagtagagcact
ATGTGTCAGTATGCTTTGTTTTCTGACACGATTACACAGCGAGGCTTTAATGCCATTTGG
GTAG
gtgagcttctgcacttctgttgtgctgaactgtattttcttctctcatctcctctttgtc
tttttctcttttcctctccttcctgccttcttctgctggcctccttttctctttctttac
cttccttggattatccttccaggttttcataataaatttatattttgtaaaaggattttg

--------------------------------------------------------------------------------