--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (35976 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (13 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1227       1247   0    Initial     21    40        Poor
ccttggtgacgcccctgcttggtgggctggcctcgccttcgccccccgacctggcacgag
cctctcgagcttccgggccgtctgctcggtgattggccgaaacagtgagtggacggccgc
ggattggctgtgctcagcggcgggctgagcaactggagtgaggggagcagttgggccaag
ATGGCGGCCGCCGAGGGACCG
gtgggcgacggcgagctgtggcagacctggcttcctaaccacgtcgtgttcttgcggctc
cgggagggactgaaaaaccagagtccaaccgaagctgagaaaccagcttcttcgtcgttg
ccttcgtcgccgccgccgcagttgctgacgagaaacgtggtctttggcctcggcggagag

Exon  2 +       1389       1523   0   Internal    135    85        Good
gggagcagttgggccaagatggcggccgccgagggaccggtgggcgacggcgagctgtgg
cagacctggcttcctaaccacgtcgtgttcttgcggctccgggagggactgaaaaaccag
agtccaaccgaagctgagaaaccagcttcttcgtcgttgccttcgtcgccgccgccgcag
TTGCTGACGAGAAACGTGGTCTTTGGCCTCGGCGGAGAGCTTTTCCTGTGGGACGGAGAA
GACAGCTCCTTCTTAGTCGTTCGCCTTCGGGGCCCCAGCGGCGGCGGCGAAGAGCCCGCC
CTGTCCCAGTACCAG
gtaatgccaggccgatcttggaagtgaccctcaccgggatcggaaccagtcttttttgtt
ccttgctcctcttggctgtttttcatcttgtggcaggcgttccagcggattgactccgac
gctgccatacgcggtcgcggggactcaggctctctcgatgcttacggcctggaggcctgg

Exon  3 +       1620       1724   0   Terminal    105    84        Good
gacggagaagacagctccttcttagtcgttcgccttcggggccccagcggcggcggcgaa
gagcccgccctgtcccagtaccaggtaatgccaggccgatcttggaagtgaccctcaccg
ggatcggaaccagtcttttttgttccttgctcctcttggctgtttttcatcttgtggcag
GCGTTCCAGCGGATTGACTCCGACGCTGCCATACGCGGTCGCGGGGACTCAGGCTCTCTC
GATGCTTACGGCCTGGAGGCCTGGGAGGAAGGAAAGGGTCATTGA
atattcaataaaaatactagtgacggatgagtgctctggagaaaaacaaagcgggctaaa
ggggttgagaacgagtgggcggagttgctatttttagtttcgtcgagagaaacctgtttc
ctgatgtgacgcttataataggttagatcgtaactttctcttgcgttgtgcacagcaagt

Exon  4 +      10088      10174   2   Internal     87   100   Excellent
ccttatgtagttaaagaataaatgaactagactactttgcaacagcaagatttttgcaaa
gaaatagttgtgataagtgttagaaaattctcaagaactgactagatggagaggaaagtg
cagttttgggaaatgaaaacagaattttaagtgctggttttcttctcttttggttgctag
AATTTACTCACTACGTGAGCCGCAGACACCCACTAACGTGATAATACTTTCAGAAGCCGA
AGAGGAAAGTCTAGTACTCAATAAAGG
gtaagtttttatttgagtcttgaaatggttttttaattagcttattgggattataaatgc
aattttaacaggttgcaaggtttttcagaggtgactagcatgcttttggtaatgtgagaa
gtaagtgtatttttagtagaacagggattcgtcgtgttggccaggctggtctggaactcc

Exon  5 +      11968      12144   2   Internal    177   100   Excellent
gaatttttaaatgttaacattcttcataatcattttttgtcttttcagtccattgcctac
aaattccatacatacccacctcctgttattagacattttgtgtttttgttttgttttgtt
tttctttttactttttgttgtttttgtttttaacaagttggtttttacatctctttccag
AAGGGCGTATACCGCATCTCTAGGAGAGACAGCAGTTGCATTTGACTTTGGGCCATTGGC
AGCAGTCCCAAAGACTCTATTTGGACAAAACGGCAAAGATGAAGTAGTGGCATACCCACT
GTACATCTTATATGAAAATGGAGAGACTTTCCTGACATACATCAGTCTGTTACACAG
gtaagttgaggtggtcacccacctgaaatgaaaactcagtttgggctccagtagatatca
ttgaggctggacttgggagccatgtttttgagtctgtggaaatgttgcagccttcacatg
cttggcttgcatatttttgagaaagagttagtacaggtcatttggcctttcatttcttca

Exon  6 +      15634      15820   2   Internal    187    97   Excellent
ggttgagaaacacagagtggtgggatctgagtgggaaagcgagaagatggagtattggga
atacactacatttataatgaaggtatgatagctggaggaaaacaaagtcaaagaatggtt
ttatgggatgagcatgcatactgtcaacatttcccaaatatgtttttactccttctttag
CCCTGGAAATATTGGAAAGCTGTTGGGTCCATTGCCCATGCATCCTGCGGCTGAAGATAA
CTATGGTTATGATGCGTGTGCTGTACTCTGCTTACCCTGTGTCCCCAATATCTTAGTGAT
CGCTACTGAATCAGGAATGCTGTATCACTGTGTCGTGCTAGAAGGGGAAGAAGAAGATGA
CCACACG
gtaagtgcaggctgctgtggttgtttgtatcttcaacacctggcatagttcctgacccaa
tatgaatgcttaatatatgagaaggaattttaacttacttatggaacttctgatattttg
gaaattaaacagttaaaaaagtagctgaagcacacttagcagtctaagtggaaagaagtt

Exon  7 +      16631      16778   0   Internal    148    74        Good
tggccaggctggtctcgaactcctgacctcagatgatccacctgcctcggcctcccaaag
tgctgggattacaggcaagaacagccgcacccggccctgacccagctttttgcctgtttt
taattgtgtacattttcaaattaacatgcaagatcaaaattacaacacttttttttacag
TCAGAAAAGTCCTGGGATTCCAGGATTGACCTCATTCCTTCTCTGTATGTGTTTGAATGT
GTTGAGTTGGAGCTTGCTTTGAAACTGGCATCTGGAGAGGATGACCCTTTTGATTCTGAC
TTTTCTTGTCCAGTCAAACTTCATAGAG
gtaagctcttcaataaatgtagtgcttttttcccatgatttttatactaagactatcata
gactgttcctatgtaatgtatttgttctgtggttccagcctttaaaaagttgactgggtt
ttttttagctttttagtcactatagtacactttttgtctaaggcagactgagcaaatttc

Exon  8 +      25896      25986   1   Internal     91   100   Excellent
cttcttggggcggaaatctagaccccctgggaaagcgtatgcctatgtcagaaaagcata
gtacttgagaagcaatgttttcagacaagaacctcactgcatttaacccaatatcattag
cattttaatttggagacttgtctaagcatcatttcatttatgtaatgtcttccatggtag
ATGAAGAAGATAAGGATAGTTTACAGGAACTCTCTACAGAACAGAAATGCTTTGTTGAAC
ACATCCTTTGTACGAAGCCATTGCCCTGCAG
gtaaggactctccctcccttgtatatcagaaaacaattgttcatttcagcagttcagata
cgtttgtatccgttacactcacatccacagtattcactgctgagtcatttgaaagttgca
gacgtgatacttctcccctaagagtgtcctgctcatcagaagctttctcctctccagggc

Exon  9 +      26660      26811   1   Terminal    152    65    Marginal
gtctcctctttgaaacacattctccttggcatccttgacgtctgtccctccaggttctcc
ttcagtcccgccagcagcccttttctcaagtttccttcttgggcgggttcctctgcctct
actcactgcttataagtaatgctcacaactctttccttgggtcttctctattctttctag
GTCCTTTCCTGAGTAACTTCTGCCGTAATCATGGCTTCAGTGCTGACAGTTCCCGCATCC
ATATCGCCCTAGCCCAGACCACTCTGAACTCCAGATTCACATACCCAGCTGCCTACTGGG
CTCCTCCACTTGGATATCCTATAGGAACATAA
aactccagatgtccccttaactcatcttctgtctttccaaatctgctctctctcctgtgt
cccatttttctgaagggtgccatatcaccccagttatccccagtagaaacctggaaggta
ttctagatacctccctttattctgttcatcaattactagatatctcataagcactctgtt

Exon 10 +      32925      33138   2   Internal    214    81        Good
gctactcgagaggctgaggcagaagaattgctcgaacctgggaggtggaggttgcagtga
gccgagatagcaccaatgcactccagcctgggtgacagagcgagactgcatctcaaataa
ataaattaaaaatataaaaagtttaaaaagcacctgtgacttgagtctatttattttcag
TTGTTTTACTCAGCTAAGGAAAATAAAGGTAGAAACTTTGTTTTTAAGAGCTTCTGAAAA
GGACATAGCCCCTCCTCCTGAAGAATGCCTTCAGCTCCTCAGCAGAGCCACCCAGGTGTT
CAGAGAGCAGTACATTCTCAAACAGGACTTGGCAAAGGAGGAGATTCAGCGGAGGTATGA
TGTCCTGTGTTCACAAACCATCGATCCCTGGCTG
gtagctgatgctgtatggtagcctagacctggcttctgaataaactctatttctttttgt
ttttaaagggtcaaattattatgtgaccaaaaaaagaaacaactagaagatctcagttat
tgtcgagaagagaggtaagtgtcaaaaataagaagaatacaataggtcagtaagactgga

Exon 11 +      33411      33491   2   Internal     81   100   Excellent
aaagaaacaactagaagatctcagttattgtcgagaagagaggtaagtgtcaaaaataag
aagaatacaataggtcagtaagactggaaccatattctcaccctaagatgctgagccaca
ttaggtggtttcagcatcaaggggtggacctcaagagtctcttgtgtcttacatcattag
GAAAAGTCTGCGGGAAATGGCTGAGCGTTTAGCTGACAAATATGAGGAAGCTAAAGAAAA
ACAAGAGGATATCATGAACAG
gtcagtgggctgtataacatttagttacctagtcaggtactaacaacgatatttaagaaa
atgggcattggcaggtgcttacatacctacggaactgaactgatccccctgcctctcctc
tgaagtatatgttggggaaaacatgaggctctcccctaacccttcctatggggcctactt

Exon 12 +      33788      33893   2   Internal    106   100   Excellent
cctctgaagtatatgttggggaaaacatgaggctctcccctaacccttcctatggggcct
acttcagaaacaccagattcatgaattatgagcttgtgattatgtttctcctaattagta
gagaccttaaattgagatgtttgcttgccttttctaaaggatgaaaaaactacttcacag
TTTTCACTCTGAGCTCCCAGTTCTCTCTGATAGTGAGCGAGACATGAAGAAAGAATTACA
GCTGATACCTGATCAACTTCGACATTTGGGCAATGCCATCAAACAG
gtaggaatagatccaaactagctaaatttggtaatttttcttaaagcacttattctacag
aaaattttacaaaaatgtaaaaagaacagattcaaatagatactgtgaaaatgtgtggca
aaccactgccaaaatatctattattttaatacttaaggttactatgaaaaaggattatca

Exon 13 +      33954      34173   2   Terminal    220    83        Good
aaactacttcacagttttcactctgagctcccagttctctctgatagtgagcgagacatg
aagaaagaattacagctgatacctgatcaacttcgacatttgggcaatgccatcaaacag
gtaggaatagatccaaactagctaaatttggtaatttttcttaaagcacttattctacag
AAAATTTTACAAAAATGTAAAAAGAACAGATTCAAATAGATACTGTGAAAATGTGTGGCA
AACCACTGCCAAAATATCTATTATTTTAATACTTAAGGTTACTATGAAAAAGGATTATCA
ACAGCAAAAGATGGAGAAGGTGTTGAGTCTTCCAAAACCCACCATTATTCTCAGTGCCTA
CCAGCGAAAGTGCATTCAGTCCATCCTGAAAGAGGAGTAA
gtaaatacttccaatcagctattatcgtgagatagtttttcctttacagtatgccagaat
caacctgtcttaatagaaacctgaatcttggtatttgcatgtcaagtaattactgggatg
agagccacatgatacatagggacttaagaaatgactatggtgggaggattgaaagggatg

--------------------------------------------------------------------------------