--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (10851 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (6 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        872        997   2   Internal    126    51    Marginal
ctggccttttcttcacagcacttacaaaatgcgatctattacatattaatttgcttattt
gcttcttgttttcctatactcccatccctcccagaagctccaagagagcatactgtttta
tccctagggcctagaataatgcgtccacgtagtaggtactcaaaattttttgcttgacag
GCTAGAAAAGGTGAATAAACACAAAGCGGGAGCGAAAAGTCTACTTCTAGGTCAGGCACT
CTTTGGACTTCACGCAACGTGTGAGCGCCACCTCTCGGGAAGCCAATTTGCTCGCGAACG
AAGGAA
gtgagtcagagaacccgggggtggagagaagaaagcaagcagctaaccggaaaggtctga
aaaagctagcgccggaagttaaactgcagaaagttgttccctagaatgactgcctactcc
caagaggaagcgtgggcgagcggtgttctgcaaaatgggctctccggcagcggatctgcg

Exon  2 +       3269       3398   2   Internal    130   100   Excellent
cacattgacatattagttcatagatcaggggactggggaggaattgggtttttaccagag
ggagacctggagctgacctgacagatttaaaccagctttatgggataatccgcttgagac
ggatgacgctgtaggcaagtgattcactgctgtttcattcctctacctgcctatccccag
AACCATGGCCAACTGTGAGCGTACCTTCATTGCGATCAAACCAGATGGGGTCCAGCGGGG
TCTTGTGGGAGAGATTATCAAGCGTTTTGAGCAGAAAGGATTCCGCCTTGTTGGTCTGAA
ATTCATGCAA
gtaagtggacttcattgttcccattttgattccttcatagtataggagaacactgtgatt
aacctgtttctccccgtctttcttatttaaagttctccacggtagagtgaacacaagtgt
cttgagacctggaaactcctcagtgccctagcgtttggctacatcttggaacaaaccaag

Exon  3 +       7598       7801   0   Terminal    204   100   Excellent
agaagtacatttagtcctgtcactgctcccttccagtgtggagaatgaattgggttataa
cagaatcagtgagcccaaccgctcatgttttacatagcagggtggatgaggggaaattaa
atggattatatgtccttagatggtttgggggttattctcattctctgtcctgttgaatag
GCTTCCGAAGATCTTCTCAAGGAACACTACGTTGACCTGAAGGACCGTCCATTCTTTGCC
GGCCTGGTGAAATACATGCACTCAGGGCCGGTAGTTGCCATGGTGAGTGTGCCTGTGTGG
GATACTCCAAGTATGCATTGCTTGTCATCTGTGCTAGGCTCTCTTCTAGACACTGGGGAT
ACAGCCATGAATGAGACCAAATAG
atacctgttttcatataccagctaatggttagtgataggcttcagaaatgaaatatgccc
agaaatgaataggagtagcaaatgatcactttagattgggtgatcaaagaacgcaatttt
taagctgtgatctgaatgacaagaagcagcgatctgaatgacaagaagcagccagccatg

Exon  4 +       7937       8041   0    Initial    105    42    Marginal
tctcttctagacactggggatacagccatgaatgagaccaaatagatacctgttttcata
taccagctaatggttagtgataggcttcagaaatgaaatatgcccagaaatgaataggag
tagcaaatgatcactttagattgggtgatcaaagaacgcaatttttaagctgtgatctga
ATGACAAGAAGCAGCGATCTGAATGACAAGAAGCAGCCAGCCATGTACAGAATCACAGTG
AAAAACATTTCCAGCCAAGCAAACAGCATGTGCAAAGGTCCCAGG
gtgggaatgagcttggctttttgaagtacgggaggagagttgaaatgcccgaagcctgat
gggtgggagggaagttgggaggtgaagagttcagaggcatgggcaggggccttctctctt
aggggtgtgttgaccatatacttcctgagtgctgggaagctatgggacacttcacacttg

Exon  5 +       8817       8890   0    Initial     74    67    Marginal
atatactctataaacatttgttcagtgaatgaatataatcttaaggggcctttttatttt
tccttttttgaattaatagttgccagattttctgctgtgattggttttcttctttgacca
tatcttcttctgtccttggaggtctgggaggggctgaatgtggtgaagacgggccgagtc
ATGCTCGGGGAGACCAACCCTGCAGACTCCAAGCCTGGGACCATCCGTGGAGACTTCTGC
ATACAAGTTGGCAG
gtgagattttggtatttttcccccttttccaaaatctgatttagttgccacaaggatttg
ggtttccgaggctggaggtagacatgataccatatgcaggttgattttatcggagtttat
tgttttcctccctcttaagttggcgtttggctttggttgttaacatcacttagtcgtacc

Exon  6 +       9346       9463   2   Terminal    118    91   Excellent
tggatgtggggagggcatttttcagccttaagtgaatggccattgtaggctttttctttt
aacatggtctaatgtccatggagcttcagcttttatgctgctgtggctgtagatttctgg
caatgggcgcattttaatccttctggtcttggtcatgtgactatctctttctccacccag
GAACATTATACATGGCAGTGATTCTGTGGAGAGTGCAGAGAAGGAGATCGGCTTGTGGTT
TCACCCTGAGGAACTGGTAGATTACACGAGCTGTGCTCAGAACTGGATCTATGAATGA
caggagggcagaccacattgcttttcacatccatttcccctccttcccatgggcagagga
ccaggctgtaggaaatctagttatttacaggaacttcatcataatttggagggaagctct
tggagctgtgagttctccctgtacagtgttaccatccccgaccatctgattaaaatgctt

--------------------------------------------------------------------------------