--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (22094 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (7 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        622        652   0    Initial     31    43    Marginal
catgcctggagaggtgcatgtgtgggacagtcaggtcggcaggagtgcatgagaacggtg
tgggcacacgtaagtgcacgatcacacatacaagtgagcttgagagtgtgtattcctgtg
cactgtgtgcacacctgtgaccccttcaaacccctcatttgagaatcaaatgatgtcgga
ATGGACTCCACCTTGAATGTCGATGGCCGAG
gtaagggcgcctgcgcccctcccctccccctaggcctctgcccagggatctcctgcactg
ggaaggggaggggtggggatggggtggaggtggggtgatggactgagatgaagggcaggg
agggcaagcgggcattcttactgatagggggcagttagggagcaaggctccagggagaag

Exon  2 +       1187       1379   2   Internal    193    84        Good
ctctaagggacaaggcagggagaagcgcagcggggtgcggggaaccgcacgccctccctt
tgcctctgcttcccaccccgaggcggcagggcgggcgggcgcggttccgggggtgggcgg
gctgggcggggcggaggcggggccgcagcactggcttcacccagcctctcccgcccgcag
CCAGAGCGAGCCGAGCCGCGGCCAGCTCCGGCGGGCAGGGGGGGCGCTGGAGCGCAGCGC
AGCGCAGCCCCATCAGTCCGCAAAGCGGACCGAGCTGGAAGTCGAGCGCTGCCGCGGGAG
GCGGGCGATGGGGGCAGGTGCCACCGGCCGCGCCATGGACGGGCCGCGCCTGCTGCTGTT
GCTGCTTCTGGGG
gtgagtgttagccggagggggcccgctccctttcccgggatcagaactccgagaagagcc
gggcgccgccaccaaggaaacagaacagagcattggggtcccagatactgagggtgggtg
gtgggaaaggacctctgatgccgggaccacgaaggagggtctagggttcccggagcgcag

Exon  3 +       7959       8100   0   Internal    142   100   Excellent
tcacttgcctttcccctgtcagctttgatgttcctaacgcctccctggtgagctcatccc
agcccaggtggttctaatagaaggcagtgggaggagggtgtttgattccccggaagaacc
ccccccaacccaccccagctttctcttgccagtctgaccctccgatctccctccatccag
GTGTCCCTTGGAGGTGCCAAGGAGGCATGCCCCACAGGCCTGTACACACACAGCGGTGAG
TGCTGCAAAGCCTGCAACCTGGGCGAGGGTGTGGCCCAGCCTTGTGGAGCCAACCAGACC
GTGTGTGAGCCCTGCCTGGACA
gtgagtagagggtggcgggcaggaggaggggagaagaatgggagggaggagaggggtgaa
agggaggggcgctggggagaagcatgcccagtagaggccttataagaccaccactgtaag
gtcatcagaagtgggtctgacccagtgtaggaggcgcttctcccagattcgagaagctga

Exon  4 +      12195      12554   1   Internal    360    92   Excellent
gctgccaccaactttcacaggctaggggtcagggtcccttggaagagggtgggagccgat
gagaaggctgaaggaggaagtcagcgtcctggcaggcaataggggagggagagactccag
ctcctgcgtcccgggtgcccaaaagagcagacgactaaatctggtgtccgctgcgctcag
GCGTGACGTTCTCCGACGTGGTGAGCGCGACCGAGCCGTGCAAGCCGTGCACCGAGTGCG
TGGGGCTCCAGAGCATGTCGGCGCCGTGCGTGGAGGCCGACGACGCCGTGTGCCGCTGCG
CCTACGGCTACTACCAGGATGAGACGACTGGGCGCTGCGAGGCGTGCCGCGTGTGCGAGG
CGGGCTCGGGCCTCGTGTTCTCCTGCCAGGACAAGCAGAACACCGTGTGCGAGGAGTGCC
CCGACGGCACGTATTCCGACGAGGCCAACCACGTGGACCCGTGCCTGCCCTGCACCGTGT
GCGAGGACACCGAGCGCCAGCTCCGCGAGTGCACACGCTGGGCCGACGCCGAGTGCGAGG

gtgagtgcggttcggggggcggggggagtgggggtgcgggggtgggctgggggcataagg
aagggcgctctctggaggtcgacaaggaccctgcctggcctgctggggcagcttggtgac
cttgaggcagcgtgcaccttccctgagcttcagtcctttcctggtaacctaagggaggag

Exon  5 +      16308      16560   1   Internal    253   100   Excellent
cccacaggccttgctctttagcatcatgacatcatgcacgcaatcccagctgtgcataac
agctgggcacaagagcacctggagccagggcggggacacaggaagaacacggcagtgggt
tagagctaaaagggaggagtgggggaagtgggtcctcactcctgtggccttttctcccag
AGATCCCTGGCCGTTGGATTACACGGTCCACACCCCCAGAGGGCTCGGACAGCACAGCCC
CCAGCACCCAGGAGCCTGAGGCACCTCCAGAACAAGACCTCATAGCCAGCACGGTGGCAG
GTGTGGTGACCACAGTGATGGGCAGCTCCCAGCCCGTGGTGACCCGAGGCACCACCGACA
ACCTCATCCCTGTCTATTGCTCCATCCTGGCTGCTGTGGTTGTGGGCCTTGTGGCCTACA
TAGCCTTCAAGAG
gtaagagagggcacggtggcgacagagaggggagatgtttgccctcaaggaagactttgc
tgtgaccttgacctgaaaacatacacacccttttaactcaaccccaaaccaagctcatcc
tcactcatcatctgccgccccactccagggtgcagcaggtcagcaggaggtgaggggaga

Exon  6 +      17788      17948   2   Internal    161   100   Excellent
atggagctttcagggtaggtgggggcagatgtgcaaagaggagccttagatggtggggtg
gcggttataattgggcacccgccatgcccctggccctcacacggcagagcacagatactc
agctgcatcggccactacagcccctcgccccctgaaacctggcctgtcctctggctccag
GTGGAACAGCTGCAAGCAGAACAAGCAAGGAGCCAACAGCCGGCCAGTGAACCAGACGCC
CCCACCAGAGGGAGAAAAACTCCACAGCGACAGTGGCATCTCCGTGGACAGCCAGAGCCT
GCATGACCAGCAGCCCCACACGCAGACAGCCTCGGGCCAGG
gtgagcagcggcccgctggggagctgaggcggagctgaggctgaggaaacagaagcaatt
aagattagactccaggaaggactgtcgggggggcggcagggctggctcagcggtgcccct
gtagatggatggagaggctggccgaggggaatgggagggagaggtcctctctagaggaac

Exon  7 +      18604      18905   1   Terminal    302    96   Excellent
gacaacgagtccccccaggtgccttcacttcctggtgccccacccaggaccttgtcttgg
ccccaggcctccagatggggaggagcactgcctcggcccttcttgggtctcaccccagtg
cccactgttggggaaaggagttcaggggtaggacctgactctcctctggtttctctgcag
CCCTCAAGGGTGACGGAGGCCTCTACAGCAGCCTGCCCCCAGCCAAGCGGGAGGAGGTGG
AGAAGCTTCTCAACGGCTCTGCGGGGGACACCTGGCGGCACCTGGCGGGCGAGCTGGGCT
ACCAGCCCGAGCACATAGACTCCTTTACCCATGAGGCCTGCCCCGTTCGCGCCCTGCTTG
CAAGCTGGGCCACCCAGGACAGCGCCACACTGGACGCCCTCCTGGCCGCCCTGCGCCGCA
TCCAGCGAGCCGACCTCGTGGAGAGTCTGTGCAGTGAGTCCACTGCCACATCCCCGGTGT
GA
gcccaaccggggagcccccgccccgccccacattccgacaaccgatgctccagccaaccc
ctgtggagcccgcacccccaccctttggggggggcccgcctggcagaactgagctcctct
gggcaggacctcagagtccaggccccaaaaccacagccctgtcagtgcagcccgtgtggc

--------------------------------------------------------------------------------