--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (31969 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (12 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1309       1335   0    Initial     27    40        Poor
attggcccaggggtgcggcttgtcctctcccggtgctctcattggccgagcgcggccgtt
gggggtgaggccgcgtcgggggaggacaacaaagggccgcgggcggcgggcagtggtgtc
ccagtctcccggtgcttccctgaggctgaggcgcccggcctcccgcccgccgcgctccag
ATGAAGTGTGAGCACTGCACGCGCAAG
gtgagcgccgcgggccggggaggcgcgcgcctggtgcttgtcctgtggggctctgggcgg
ccgaggttggcggtccgggcccgccgctcgctcgcttcagggctcttcaaggcgcccccg
gcctcggcaccctgggcccgctcggcgtggaggcggccggcgcggggtccgctgcgctct

Exon  2 +       1436       1883   2   Terminal    448    53    Marginal
cccggtgcttccctgaggctgaggcgcccggcctcccgcccgccgcgctccagatgaagt
gtgagcactgcacgcgcaaggtgagcgccgcgggccggggaggcgcgcgcctggtgcttg
tcctgtggggctctgggcggccgaggttggcggtccgggcccgccgctcgctcgcttcag
GGCTCTTCAAGGCGCCCCCGGCCTCGGCACCCTGGGCCCGCTCGGCGTGGAGGCGGCCGG
CGCGGGGTCCGCTGCGCTCTGCAGGGCGGGTTCGGTCTTCGCGGTTCTCCCTGAACTTGT
CCATCTTTCCCACGCCCGCGAAGCGCGGAAACGCACGGAGACCGAGCCTCTCGTGCCGCG
CACCACAGTCCGAGTAAACAGCGGTCGTGGCGGGAATGATCAGAAGCGTTTCGAGAGGGT
TTTAGGCGTTTTCGAACCTGCCCCTCTGAGGGTCACCGAGCAGCCGGTGCAGGGGCGGAA
GCGGGTGACGGCTGCTGACCGGCGCCTTCCGCGGTTGTCTCCAGGCCATGGCAACAACCG
CGCAGCGCACGCAGGGGGGTTTTGTAGCTGTTATTGCCGGAATGGGCTCCTGTGGATGCT
GCTCTGTGGCTGGCACTTCTGCGCGTGA
cgccgtggcaggaggcttcctaacattccatgggtcgttcatccccggtggtggctgcgt
cctattctaagtacacctgtgtccaggggaattcgcctgtggggtgaaggctacagttgc
ttctgcttttttattattgtaaacaatagagatgtgtgtgtgtccttcagtacctgtttc

Exon  3 +       6792       6935   0   Internal    144    98   Excellent
ccaccttgagctgctcagtggcagagactgtcctgcttccagccccttgagcaccaggcc
tggaccctggtattatctccaatgtttactgtgaattctgtatatgggtgttaccctctc
taaagaagcacattaaagagtatttgttgaataatcatgctgaaacgtcatctttcatag
AAGGGAGAATTCCACAAGTTGGCTGATGCCAAGATATTTTTGAGCGACTGCCTGGCATGT
GACAGCTGTATGACTGCAGAGGAAGGAGTCCAACTTTCCCAGCAAAATGCCAAGGACTTC
TTCCGCGTTCTGAACCTTAACAAG
gtaaggcattcggggcatttgctgatgctggggagctgacctggaggaagtggaggtgag
gcctggcttcctgcacagaagcctctgctgggacatcggatgcacatctcagccttttcc
tggtgttgctaacatcctgctttgaccttccaaacctctccatcaagagcaaaatccccg

Exon  4 +      11269      11401   0   Internal    133    71        Good
ctcaccataatcctgattttttttctcctttttcttaattatgtttgccagtgtttgtct
attttattagtctttgcatagaccatctattaacgttgttctgaatttctcattaaggtg
tgtaacttttactccttgtgtaatcagcagatacctaacattctctatttctccttctag
AAATGTGATACCTCAAAGCACAAAGTGCTGGTAGTGTCTGTGTGTCCTCAATCTTTGCCT
TATTTTGCTGCTAAATTCAACCTCAGTGTAACTGATGCATCCAGAAGACTCTGTGGTTTC
CTCAAAAGTCTTG
gtgagtcatcttttgataaattgggaatgtataacttgagtttataagcgccctttttaa
tctctaaagttcgtttttcaaggacgcagggtagataagcaacttccaaaagagtctctt
ggaacgtaaaaagaccatgtcccgtgtgtcatgaaacccagcctctgatcgatggtagac

Exon  5 +      15069      15203   1   Internal    135   100   Excellent
tgaggtgggaggatcacttgaacctgggaggcggaggttgcagtgagccgagattatgcc
actgcactctagcctgggtgacagaacgagactccgtctcaaaaaaaaaaaaaaagagga
agcctaaaagtagatcttttagtacgtgatttaagctgaatatgctcctctctcctgcag
GGGTGCACTATGTATTTGATACGACGATAGCTGCGGATTTTAGTATCCTGGAGAGTCAAA
AAGAATTCGTGCGTCGCTATCGCCAGCACAGTGAGGAGGAACGCACCCTGCCCATGCTGA
CCTCTGCCTGTCCTG
gtgagcccctggacccccgctctgttggcctgaggtgccaaaagaggtttcacaagattc
tgcaggctctagatgaggttggaggcagacagacccatcccacccagccttgtagaccag
gagggaagagcttggcctgattcacagagggtgtttgatgttttgggacagccaatttag

Exon  6 +      21113      21172   0   Internal     60    81        Good
ggctgtaaggacgctgtagctggccaggcgattttgcacggtgcagcctgggccgctgct
cctgctgcctttcagtgcttgttccccttcacctttttgggggacctgttactccgactc
ttacttgtctgtcggccttgcagggatgctcccatttcccagtagcctccaggcctgcag
GTTCCCATGACCCACAGCCGGGCCACCGAGGACGGGTTTTGGGTCCAGCACGAGCTCCTG

gtaaggcctggggaaaaggtgttctggcttcaccctggggcggcagggactcgagctcag
cattccctggtgcgttacaggaagaccagaggaagcagtaaggagctgaccgtggatccc
ttctctccccaggctgggtccgatacgccgagcgggtgctgggtcgccccatcactgccc

Exon  7 +      21305      21423   1   Internal    119   100   Excellent
cacagccgggccaccgaggacgggttttgggtccagcacgagctcctggtaaggcctggg
gaaaaggtgttctggcttcaccctggggcggcagggactcgagctcagcattccctggtg
cgttacaggaagaccagaggaagcagtaaggagctgaccgtggatcccttctctccccag
GCTGGGTCCGATACGCCGAGCGGGTGCTGGGTCGCCCCATCACTGCCCACCTCTGCACCG
CCAAGTCCCCCCAGCAGGTCATGGGCTCTTTGGTGAAGGATTATTTCGCCAGACAGCAG
gtaagctgacctctctggagggcaggaagggcaggtgagggaggaccatggcacaggggc
ccaggaaggggaggttccccatctgtccagcgtggtcacggccccccaggtgagcaaaaa
ggaagctgtggcttcaggaaacatcagcagtgctgtttctcaccaacgcccgtctctatt

Exon  8 +      23587      23716   0   Internal    130    97   Excellent
aacctggtgacagagcaagactccatttcaaaaaaaaaaaaaaaaaaagagtgcagcatg
cagtgtctggagggcagcagcagggggcattcggtctcccatccctcttgttctgggcac
caagcgtaagctgccgtcacctcttcaccagccctaaatatgggtgcccctctcccacag
AACCTGTCTCCAGAGAAGATTTTCCACGTCATTGTGGCCCCTTGTTATGACAAGAAGCTG
GAGGCTCTTCAGGAAAGCCTTCCCCCTGCTTTGCATGGCTCCCGGGGCGCTGACTGCGTG
TTAACATCAG
gtgagaggtgggcgggggtgcacctgggcgctggggtaatctcctactggccagtacaca
ccagagccaggcagatctgtgtcccagagccatctcagtgcctgccaatgtggtcgcttg
tctgaagttactgacagctgagggtcctaggggcttaactgcaggtgaagagaagggtca

Exon  9 +      26221      26284   1   Internal     64    83        Good
tttattagtgtttcattttattggcctcactttgccctttagatggactcctgctgtgtg
tgatggagatttcataagagggaggtcacccagggtcactaatgtcaaatctcctgcagg
ggaagaaaagttcctgtggccacctgtgtcttttcagtgtcttacttcgtttgtctgcag
GTGAAATTGCTCAAATAATGGAGCAAGGTGACCTCTCAGTGAGAGATGCTGCCGTCGACA
CTCT
gtaagtggcttctctggggagagtcctctggggggcaggacctctcgtcagccctgccag
ccacctgccaggcccagggctgccctgctttatgacgaggccatgtgaagcactgcgatg
cagtcccccaggcccctgccacaaccctcagccaccctatagctgttgaatgggatacca

Exon 10 +      27281      27455   1   Internal    175    97   Excellent
ctgagagtcctccgccttgcccgagcatcaggcaggccctcccaagacccctcaagatgc
tagaatgggactttctgcaaagtttaaacatctgtacaggatttagcttctttggtggcg
aacttggattgtgatgccctcaggaagtctggtttcactctttctgtcactgtacgtcag
CATTCATGAAGGACTTGTATTTTCTCTGCCTTGTGAGGTTTGGAGACTTGAAGGAGGACA
AAGTGACGCGTCATGATGGAGCCAGCTCAGACGGGCACCTGGCACACATCTTCAGACATG
CGGCCAAGGAGCTGTTCAACGAGGATGTGGAGGAGGTCACTTACCGAGCCCTGAG
gtgtggggcagtatccacagcctgtctgtgcctgtggttagcacgtgtgcatggtgtgcc
tgtatggatctgtgcatgtggcggttctatggatggagtttacactagtcaaaatcaaaa
ggacttttttgtgtttattcagaccttttattttgctgacattccaaacttacattagaa

Exon 11 +      28002      28159   2   Internal    158   100   Excellent
aagctgaggcaggagaatggcgtgaacccgggaggcagaggttgcagtgagccaagatgg
tgccactgcactccagcctgggcaacagagcaagactccgtctcaaaaaaaaaaaggaag
tgttcttaagtcacagataaaggacttgatggatcaaaattctctgtgttcattttgtag
AAACAAAGACTTCCAAGAGGTCACCCTTGAGAAGAACGGAGAGGTGGTGTTACGCTTTGC
TGCAGCCTATGGCTTTCGAAACATCCAGAACATGATCCTGAAGCTTAAGAAGGGCAAGTT
CCCATTCCACTTTGTGGAGGTCCTCGCCTGTGCTGGAG
gtgaggcgccaagagcagcacctggctctgtctcccacgggtgctcaggccacactggtc
ctgcagctgccagagagatggtgctcttggccacccagagcctctctcagccctgagagc
tttgtagggtatggatgctcccgtggggcttgtgctgggacattctaggctccattggtt

Exon 12 +      30421      30662   1   Terminal    242    96   Excellent
ccaggagttcaagaccagcctgagcaacatagcaacacccgcccctcccgcccaatctct
acaaaaaatttaaaaatcagccgggcaaggtggtgtgtgtctgtagttctagctgctcag
gaagctaaggcagaaagatcgcctgagcccaggataaacttacctgtgtttatctttcag
GATGCTTAAATGGCAGAGGCCAAGCCCAGACTCCAGACGGACATGCGGATAAGGCCCTGC
TGCGGCAGATGGAAGGCATTTACGCTGACATCCCTGTGCGGCGTCCGGAGTCCAGTGCAC
ACGTGCAGGAGCTGTACCAGGAGTGGCTGGAGGGGATCAACTCCCCCAAGGCCCGAGAGG
TGCTGCATACCACGTACCAGAGCCAGGAGCGTGGCACACACAGCCTGGACATCAAGTGGT
GA
agtcaggccagggccttccagctgctcttggggccagagccaagagcctctcagtagagg
gaggggctgccctgagtggagtattaaagacacttaagaaaaccgctcaatggattactt
tggtttctccgagttccctgctaccccgtttattggaggcccctcaggcagtttcatgtg

--------------------------------------------------------------------------------