--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (19263 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (11 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1413       1485   0    Initial     73    67    Marginal
gagagacattgatttttctccccgtgctcccccgttcttccctgcggagtgcgctgcgcc
gcccagccctgtcgccccccggaggtgatccctccctcctgcctgcccgccagcctgacc
tgtgcccggctcgcgggccgcagcctcggccccggcgcgcccccggcagctctcggcgcg
ATGAGCATAGAGACGCTACTGGAGGCGGCCCGCTTCCTGGAATGGCAAGCGCAGCAACAA
CAGAGAGCACGTG
gtgagcggccgggctgggcccctggggcactggggaaggggaagcgagtgaccccggtcc
ccgaacccacgcgaaaccgcggacagggccccctcccgggcggcctgcggagcctggcag
cgcacggctccccgcgagagccgccgcctggggaggggtgatgtgggcagtgaaattaat

Exon  2 +       5733       5810   0   Internal     78    53    Marginal
gcgggtggtggggtgcactgccctgctcagcccccattgaagagcccagccccttcttgt
ttgggagaaatggtcgctgctgtacctcctcctcctcaactgccctctctcacccagaac
caggcaggtgcactttccccggtgcctggctggagtggttgggtatttgtattgtctcag
GCTGAGCGGGGTGTCACTGAGGATGTCAGAGGATGCTTTAGGCCTGAAGGACAGGACATG
CTGGCGCTGCTGCTGGTG
gtggggatgttggggatttggggaaaatgagttataacacgagaagggtcagagagggac
gaagtgtgtttgttgaatggtccctgaggaaaacaggcattgggacctagcctcggagtc
aagagtgctgggctgtttccacatgtgtgaaatgagggtgatgtccctgtcctgcccatg

Exon  3 +       6671       6797   1   Internal    127    83        Good
tcactgctgtgcccccggcactttcccccgtgcctggctgggctggtaggctatttgtgg
tgtctctcgctgagcaggggtgtcactgagtactgactgggctagggtcagaggacgagt
tagggctggagttctggggccccgctgagaccctcccccccttgtgttctctctgtgtag
AGGAGCAGGAGCGGCTTCGCTTGGAGCAGGAGCGAGAGCAGGAACAGAAGAAGGCCAATA
GCCTGGCCAGGCTGGCACATACCCTTCCTGTGGAGGAACCCCGCATGGAGGCGCCACCCC
TGCCTCT
gtctccaccggctcccccgccggcacccccaccaccacttgccacccctgccccactgac
tgtcatccctatccctgtggtgaccaactcccctcagcctctacccccacccccaccctt
gcccgcggcagcccagcctctgcccctggcgcctcgtcagccggccctggttggcgcccc

Exon  4 +       7127       7250   1   Internal    124    66    Marginal
cgcctcgtcagccggccctggttggcgcccccggactcagcattaaggagcctgcccccc
tgcccagcaggccgcaggtgcccacccctgctcccctactgccggactcgaaggccacca
ttccacccaatggcagccccaagcctttgcagcccctccccacgcctgtcctgaccatag
CGCCACACCCTGGAGTCCAGCCTCAGCTGGCCCCCCAGCAGCCGCCCCCACCCACGCTGG
GGACCCTGAAGTTGGCACCAGCTGAAGAAGTCAAATCCAGTGAACAGAAGAAGAGGCCCG
GGGG
gtgagtggggtgtggcggggtcgggctggtgggggataggagaggtgcccatcccccggg
ctgtgtgcaagacaaggtgccctccccagcttagaagtgccccctgtatttgaacacgtc
atcactgtgcccatgtctatcctgggaaggaatgtcccattgccccccgttcccaggctt

Exon  5 +       7779       7820   2   Internal     42    49    Marginal
agcacagatgtgtcctccagggggtgggcgcagcatggcacagggcgaacgtctcccagt
ctgctttaagacagtgttggggacaaacagcctgtggcaattttgcgggtggcggcgctg
gtcaggaaggccgtctaatcgagtcctcctccctgagcctcctatctgtctgggtttcag
GATCGGAACCAGAGAAGTCCACAACAAATTGGAGAAGAACAG
gtgtgtgtgtgtgtgtgtgtgtgtgtgcgtgcgtgcgtgcgcgcgcgacccgggccccgg
cggccctcggccccagcttccccggtcctgcctccccccgtcccagccccgccccaggca
ccgctgaccggcgctcgcccctctcttcaggagggcccatctgaaagagtgctttgagac

Exon  6 +       7971       8082   2   Internal    112   100   Excellent
agaagtccacaacaaattggagaagaacaggtgtgtgtgtgtgtgtgtgtgtgtgtgcgt
gcgtgcgtgcgcgcgcgacccgggccccggcggccctcggccccagcttccccggtcctg
cctccccccgtcccagccccgccccaggcaccgctgaccggcgctcgcccctctcttcag
GAGGGCCCATCTGAAAGAGTGCTTTGAGACCCTGAAGCGGAACATCCCCAACGTGGATGA
CAAGAAGACGTCCAATCTGAGCGTGCTGCGGACGGCGCTGCGGTACATCCAG
gtatggggcccggaggccggcgtcgcgcagcttcccccgccctccctccgccgcccctcc
cccggccgcgccccgccccgccctcacgccccggcggctcccccgcgcctccctcccacc
tccacgcgggcgctgagcacatggcccggctgacgtcagcggggctccctgcccgggagg

Exon  7 +       9705       9769   0    Initial     65    59    Marginal
aacctgggcttggttgtagtttagtcgcagggctggctgagggtgttcatgcagacactt
cgctgcactcccgacatttgcttagctattatttttgagaaataggaaggacggcatggc
gagttcctctttgcagatactacttgcagagggcgccttgcgtaacgtgtgggtttggaa
ATGAATCGGAAGAAGACTCAGCAGCAGCCGCAGAAGGAAGCTCTTGAGGAGCTGGGCCCG
GTGAA
gtaggagccggggtaggcctcactcaggctgtgcagaagggacacccattctggtgctgg
tcacagaagcaggaacctcaaaggcctgtctacaaaccatttattcatttattcattgag
gtgcttttagcgaagtctctgcttctgggcgaatggtggcgagcaagtaaaaaagcctgg

Exon  8 +      12373      12512   0   Internal    140    83        Good
aattttgtttgcagttcttacattctcagtgtgagccaatctgtgacccaccgccccacc
cagaagtggcccagtcctggtgcagggtaggaagggaagggtggagtgagaagagcccca
tttttcctcagtgccagggggctggagacaccacccccttctcctgcctctgggctccag
GAAGGAGTGCAGATGGACTCTCAGGCCTATGGTTCCTCCTCCACACCACTGTCCCCCAGG
TTGGAGGGGAGTGAGAGATACAGGGAGAGAAGGGGACAGAGGCAAGAAAAGGTGTTGATC
AAGAAAGGCAAGAACCAGGG
gtgagggctgacagagaatcaaagataaaacactagtaggccgggcgcggtggctcatgc
ctgtaatcccagcactttcggaagccaaggcgggcagatcacctgaggtcgggaattcga
gaccagcctgaccaacatggagaaaccctgtctctactacaaatataaaattagccgggt

Exon  9 +      14076      14268   0   Internal    193    99   Excellent
ctcactgggcaggggcatggaccacaacaggtgcggtctccagcagcccccgtcaggctg
ggcccgctggttgccacggacttgcctctgtgggccagctgatagggagaggtttgtggg
ggctttgggccccaaggctgctgctcagggtgtcctgctgtcccttactctgtgtgccag
TCCCTGAAGAGGAAGGAGAAGGAATATGAGCATGAAATGGAGCGGCTGGCACGTGAGAAG
ATTGCCACGCAGCAGCGGCTGGCAGAGCTCAAGCACGAGCTGAGCCAGTGGATGGACGTA
CTGGAGATTGACCGCGTGCTGCGGCAGACGGGCCAGCCCGAGGATGACCAGGCCTCCACC
TCCACCGCCTCTG
gtgagccccagcccccacgctggccccccagccctcagatgttacacctcaaattccagc
ctccctggccaggctctttcttgcctgctagaaaagatggccctggccccagccccatca
cattcccacgcccccacgagcatctacgcctccagccacttgcttccccgcccttctgac

Exon 10 +      14476      15224   1   Terminal    749    76        Good
ccagccctcagatgttacacctcaaattccagcctccctggccaggctctttcttgcctg
ctagaaaagatggccctggccccagccccatcacattcccacgcccccacgagcatctac
gcctccagccacttgcttccccgcccttctgacctgctccctgccccatgttccccacag
AGGGTGAGGACAACATAGACGAGGATATGGAGGAGGACCGGGCGGGCCTGGGCCCACCTA
AGCTGAGCCATCGTCCCCAGCCGGAGCTGCTGAAGTCCACCCTGCCACCCCCCAGCACCA
CCCCTGCGCCTCTGCCTCCACACCCACACCCTCACCCCCACTCCGTGGCCCTACCTCCTG
CCCACCTCCCCGTGCAGCAGCAGCAGCCACAGCAGAAGACCCCTCTGCCAGCCCCTCCTC
CCCCACCGGCTGCCCCTGCCCAGACACTGGTGCCAGCTCCAGCCCATCTGGTGGCGACGG
CTGGGGGTGGCTCCACGGTCATCGCCCACACAGCCACCACTCACGCTTCAGTCATCCAGA
CTGTGAACCACGTTCTGCAGGGGCCAGGCGGCAAGCACATCGCCCACATCGCCCCCTCGG
CCCCCAGCCCTGCGGTGCAACTGGCGCCTGCCACACCCCCCATTGGGCACATCACTGTGC
ACCCTGCCACCCTCAACCATGTGGCCCACCTGGGCTCCCAGCTGCCCTTGTACCCGCAGC
CCGTGGCAGTGAGCCACATCGCCCACACCCTCTCGCACCAGCAAGTCAACGGCACGGCCG
GCCTGGGGCCCCCGGCTACTGTCATGGCAAAGCCGGCCGTGGGGGCTCAGGTGGTGCACC
ACCCCCAGCTGGTGGGCCAGACCGTGCTCAACCCTGTGACCATGGTCACCATGCCCTCCT
TCCCAGTCAGCACACTCAAGCTGGCTTGA
ggacgaggccactcagaggcccccagtggggacagggagggggacctgtcccccactctc
tcacccaccagctccacacattccagccaggcccaggccagcccccccacccacccccag
gcctcctaggggaagggggtgcaaagactctgagccaagggagggaagggccaccctgct

Exon 11 +      15527      15605   0   Internal     79    53    Marginal
ctcctaggggaagggggtgcaaagactctgagccaagggagggaagggccaccctgctgc
actaggacttggtaagatgactctgagaaaatgcgagactctgatggaatgtgccacctg
tccggcccagtgccagctccagtgccgctcctgcttcccctccctaccctcggaaatcag
TGCGATGTGGACGTCACGCTCCCTGACTTCTCCCCCGCCCTGCCCCGCCTTCGTGTGCTG
CTGCTGCTATTGCTGTCTG
gtgaggtggcccaggcccccggctttcctccggagcctcatgttctcttcccaggccttt
ggaggggaaatggggaaagcagaactgaagccacttggcccagaaagctgcggattgggg
tgataaggggccttgctctgagcacaggtgacagatcataggaagtggctggtctggagt

--------------------------------------------------------------------------------