--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (8186 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (6 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       2349       2580   0    Initial    232   100   Excellent
cccccggctctgggcccggacccctggggtagctagtctgccacgaaccagccgcgcgct
tctgcccttgtcggtttaggaaactgggaagttccctggtcctgctccccagcccgcaga
ggggacactgaggcccacggtaggtggtcctctcctcacccgagtctccacacagacacc
ATGGCCGAGCCTCTGAAGGAGGAAGACGGCGAGGACGGCTCTGCGGAGCCCCCCGGGCCC
GTGAAGGCCGAACCCGCCCACACCGCTGCCTCTGTAGCGGCCAAGAACCTGGCCCTGCTT
AAAGCCCGCTCCTTCGATGTGACCTTTGACGTGGGCGACGAGTACGAGATCATCGAGACC
ATAGGCAACGGGGCCTATGGAGTGGTGTCCTCCGCCCGCCGCCGCCTCACCG
gtgagcttcctgagccgtcgcctcccagatgtggcagcgtcgcagggagtgggaaaccgg
cctgtcccagacagccgggaaggaaagcggggtgcgagttctggctccagtcaacacaca
ctgaccagggccttctgcctgccaggctccggggaggctcggttctctgaaactccggcc

Exon  2 +       3230       3395   1   Internal    166   100   Excellent
gaaggtaacatttaataatgtaggtaacatgcttagcacagggcttggcacatagtaggt
acccaatacttggtagctgttgtcatttgcatcctagaagggaggtgttgataggggctg
agtcgactctgcagtttctccaaggtatcctctggtatgtcccttttccctgctcctcag
GCCAGCAGGTGGCCATCAAGAAGATCCCTAATGCTTTCGATGTGGTGACCAATGCCAAGC
GGACCCTCAGGGAGCTGAAGATCCTCAAGCACTTTAAACACGACAACATCATCGCCATCA
AGGACATCCTGAGGCCCACCGTGCCCTATGGCGAATTCAAATCTGT
gtaagaagcgggatgggagagggagccagacttgggacttttctgaaggctgcaaccatg
ttgccgaagttctggaaaggcagctgaatctaatctgaagcaggctgggaaaattcccgc
agttctaggaccagttctttagagttttgccagggacaactgttattcctcaagaagtgt

Exon  3 +       4056       4918   2   Internal    863    94   Excellent
ggaaaagtcgtagagaatctaaaacgtgatgctcttcttccataccatgccgtcagcccc
tatggggtcccagggtaaggctgttacctgtctggaatcggaagggtgtggtgaggatgg
ggcttgtccctggagtgtgatcaggccaacccatgcttctctccttccttccccttccag
CTACGTGGTCCTGGACCTGATGGAAAGCGACCTGCACCAGATCATCCACTCCTCACAGCC
CCTCACACTGGAACACGTGCGCTACTTCCTGTACCAACTGCTGCGGGGCCTGAAGTACAT
GCACTCGGCTCAGGTCATCCACCGTGACCTGAAGCCCTCCAACCTATTGGTGAATGAGAA
CTGTGAGCTCAAGATTGGTGACTTTGGTATGGCTCGTGGCCTGTGCACCTCGCCCGCTGA
ACATCAGTACTTCATGACTGAGTATGTGGCCACGCGCTGGTACCGTGCGCCCGAGCTCAT
GCTCTCTTTGCATGAGTATACACAGGCTATTGACCTCTGGTCTGTGGGCTGCATCTTTGG
TGAGATGCTGGCCCGGCGCCAGCTCTTCCCAGGCAAAAACTATGTACACCAGCTACAGCT
CATCATGATGGTGCTGGGTACCCCATCACCAGCCGTGATTCAGGCTGTGGGGGCTGAGAG
GGTGCGGGCCTATATCCAGAGCTTGCCACCACGCCAGCCTGTGCCCTGGGAGACAGTGTA
CCCAGGTGCCGACCGCCAGGCCCTATCACTGCTGGGTCGCATGCTGCGTTTTGAGCCCAG
CGCTCGCATCTCAGCAGCTGCTGCCCTTCGCCACCCTTTCCTGGCCAAGTACCATGATCC
TGATGATGAGCCTGACTGTGCCCCGCCCTTTGACTTTGCCTTTGACCGCGAAGCCCTCAC
TCGGGAGCGCATTAAGGAGGCCATTGTGGCTGAAATTGAGGACTTCCATGCAAGGCGTGA
GGGCATCCGCCAACAGATCCGCTTCCAGCCTTCTCTACAGCCTGTGGCTAGTGAGCCTGG
CTGTCCAGATGTTGAAATGCCCA
gtccctgggctcccagtggggactgtgccatggagtctccaccaccagccccgccaccat
gccccggccctgcacctgacaccattgatctgaccctgcagccacctccaccagtcagtg
agcctgccccaccaaagaaagatggtgccatctcagacaatactaaggctgcccttaaag

Exon  4 +       5229       5506   1   Internal    278    72        Good
accaaagaaagatggtgccatctcagacaatactaaggctgcccttaaagctgccctgct
caagtctttgaggagccggctcagaggtgccttgtgggcaggtcgggtgggcagagggga
gacttggacttggacaaggcttcaggcttttaccttctcccctgcccaacttccccgcag
ATGGCCCCAGCGCACCCCTGGAGGCTCCTGAGCCTCGGAAGCCGGTGACAGCCCAGGAGC
GCCAGCGGGAGCGGGAGGAGAAGCGGCGGAGGCGGCAAGAACGAGCCAAGGAGCGGGAGA
AACGGCGGCAGGAGCGGGAGCGAAAGGAACGGGGGGCTGGGGCCTCTGGGGGCCCCTCCA
CTGACCCCTTGGCTGGACTAGTGCTCAGTGACAATGACAGAAGCCTGTTGGAACGCTGGA
CTCGAATGGCCCGGCCCGCAGCCCCAGCCCTCACCTCT
gtgccggcccctgccccagcgccaacgccaaccccaaccccagtccaacctaccagtcct
cctcctggccctgtagcccagcccactggcccgcaaccacaatctgcgggctctacctct
ggccctgtaccccagcctgcctgcccaccccctggccctgcaccccaccccactggccct

Exon  5 +       6261       6394   0   Internal    134    96   Excellent
gagacaagttaaatatggcctgcaaagtgcctagcccagagatggggccagccagcactc
actgactgccgagactggtgttagcactcccagatatccaggcggagtagtcagcagcat
tgggacagggtggcctacagacctcagtctgtctgcattgtaacctgtcattccctgcag
GTGGAGGACCCCCTGCCCCCTGTGTTCTCAGGCACACCAAAGGGCAGTGGGGCTGGCTAC
GGTGTTGGCTTTGACCTGGAGGAATTCTTAAACCAGTCTTTCGACATGGGCGTGGCTGAT
GGGCCACAGGATGG
gtaaggtggctggactgagctcctagactgggactgtggggagaggttcctggtgcagga
gacatgcacctgtgggatgggtgagggtccagcctaggctaatagcacccctccctttcc
ttcccctgcagccaggcagattcagcctctctctcagcctccctgcttgctgactggctc

Exon  6 +       6526       6679   2   Terminal    154    89        Good
tcttaaaccagtctttcgacatgggcgtggctgatgggccacaggatgggtaaggtggct
ggactgagctcctagactgggactgtggggagaggttcctggtgcaggagacatgcacct
gtgggatgggtgagggtccagcctaggctaatagcacccctccctttccttcccctgcag
CCAGGCAGATTCAGCCTCTCTCTCAGCCTCCCTGCTTGCTGACTGGCTCGAAGGCCATGG
CATGAACCCTGCCGATATTGAGTCCCTGCAGCGTGAGATCCAGATGGACTCCCCAATGCT
GCTGGCTGACCTGCCTGACCTCCAGGACCCCTGA
ggcccccagcctgtgccttgctgccacagtagacctagttccaggatccatgggagcatt
ctcaaaggctttagccctggacccagcaggtgaggctcggcttggattattctgcaggtt
catctcagacccacctttcagccttaagcagccacctgagccaccaccgagccatggcag

--------------------------------------------------------------------------------