--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (51882 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (25 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +      18902      18976   0    Initial     75    95   Excellent
gtgcatgggcggtcactgtgaagctggcctggccccggggtggcagcctactggacttgg
agagagaggccctgctccacctgtttgggccgggcctaatcgatacctgagtgccaggac
agacccctgcagctccttctgtttctccaggtctccagtgggggctgcagactaagcaaa
ATGAGGCGGTTCCTGAGGCCAGGGCATGACCCTGTGCGGGAGAGGCTCAAGCGGGACCTG
TTCCAGTTTAACAAG
gtaagttagggagagcagggaagatgacccccaggttttcggccaagcagctcaggctgg
ggctgaggcacctcttacctggattaaggtatagctcttatgtgactgcctgcagtgcct
cttgggactcagactttggaaatggggcctggttaaagggcttttatagaaaaggggaat

Exon  2 +      19395      19487   1   Internal     93    50    Marginal
ctgcaagtcactccacctcatggagcctcagtttccctacctgtatcatgggaataaaac
gatctgccatgtctacctcggcacagggttgtcaaggaggtttagggacgtgggagatga
aaggatgaactcttcagggggtgataatgttccaggtcccttggggccctggagtcacag
GCCATGGCTGTTTCTCCCTTCTCAAATTGCCCCTGAAGGAAAATGCAGCTCCCCTGCAGG
CTGAACACGTGATTCCTTCTGGCTCCGGCCGGG
gtgagtggggagaggtgcccaggagaatgagccggagttggcctcggactaccccaatcc
caaacctgtatccggggtaccagaaggcccacggggcttcccttcaggagtctggggcct
gagaaggtcaggacgggcctgtacgcaggaggcgtgcagtgtggctcttcagctcccggg

Exon  3 +      26834      26879   0    Initial     46    51    Marginal
ggtccctccagagttgccaacttggagaagtgcccaaggtgatactatggaacaatgcga
gcctcggaaggaagcagaggcctgtgtgtgctgcagggtggcctcagatccatcatctcc
aatccaaggacagctctgcccagtgcagtcaccagtaccatcccgtttattagatgagaa
ATGAAGCTCAGGGAGGCCCAGCAGCTCATCCACGACCAGATGCCTT
gtacgtggcaggaagggatacaaagcttagtgggtctgactcagtccctgttctaaatca
gcctttggaaaagaaggtggggatgggggggaggggtggccacgataactccaaggcttg
aagggaatgaggaatgaatgcgggtggttgaaggatgggcccaaccctttgtcttcctct

Exon  4 +      31521      31660   0   Internal    140    87        Good
gggacagggggtggggcctggtaaatatgggttaggctccaacactcaggtgtctgggag
gaaccggaaaggtaccgaagccctgcttcctgctgggtcgtctggtgctgcagctgcagc
agccatggtggcgcgaaggggacaggtctgcaggcccaccccacgtgcttctcgttgcag
ACGGTGGAGCATGGCTTCCCGCACCAGCCCAGCGCCCTCGGCTACAGCCCGTCCCTGCGC
ATCCTGGCCATCGGCACCCGTTCTGGAGCCATCAAGCTGTATCCTCCGTCCCCTCGCTCC
CACTCGGGCAGGGCCTTGGG
gtgggtgagatttggggagggacatcttttccttccttgcccgtgggctgttgggataaa
atgagggactttcctgatttccagttttggacatgattttattccaaaatggggcaggta
tggttgatggtggagcaggcacctgggcatgagtgcatccctggtgggatgcgaccctgt

Exon  5 +      33630      33711   2   Internal     82    88        Good
agggccagggctgctgtgtctcctccccaccctaggctccatgcatgggtcctgctgcct
cgggggagggcagcccctctctgtgtttgcatcattgcacatgggccccgagggcctggc
actcaaggcaggcaggggatggtgtccgaccttccagagctttcctgagcctactcctag
CTACGGAGCCCCAGGCGTGGAGTTCATGGGGCTGCACCAGGAGAACAACGCTGTGACGCA
GATCCACCTCCTGCCCGGCCAG
gtgagggacctggggtgggacaggaagccacttccatgccctccttgccttcactgcttc
cagcagggctggtgtggagaggctggcattcggtggccctgggtttgctgctgatggaaa
gacctgggaccccctccctttccacagctggggctcatgggccaccctgggagtggccag

Exon  6 +      33987      34102   0   Internal    116   100   Excellent
gccctgggtttgctgctgatggaaagacctgggaccccctccctttccacagctggggct
catgggccaccctgggagtggccagggggtcttttaaacaactggggctgcgtggcccca
gtgtgtaaaggccttgcctgggtagcaagaccacatgatcccgtcgtgtgccctcgccag
TGCCAGCTGGTCACCCTGCTGGATGACAACAGCCTGCACCTTTGGAGCCTGAAGGTCAAG
GGCGGGGCATCGGAGCTGCAGGAGGATGAGAGCTTCACACTGCGTGGACCCCCAGG
gtaagggctcaatccccagccccttccactcccagcccagcctgacccttgcccttagct
ctggagtggactcaccctttgtgaggcctgttgcgcccctggcagtgactggcatgcgtt
tggcccgatgcatcgccacactcaggtgctccgagtggagtgggcggggctgcagcctgc

Exon  7 +      34727      34885   2   Internal    159   100   Excellent
ggctctctgccatctgtctcctgtcttggcagaaagtgaccaatgtttgtcctggcttga
aatgttatgacctcattaaagggccttatgggcttgttttccgaggagtcaggggacccc
gtccatggcatctcccctgctgggcagtggtcggctcacgggcagctgttcttgtcacag
GGCTGCCCCCAGTGCCACACAGATCACCGTGGTCCTGCCACATTCCTCCTGCGAGCTGCT
CTACCTGGGCACCGAGAGTGGCAACGTGTTTGTGGTGCAGCTGCCAGCTTTTCGTGCGCT
GGAGGACCGGACCATCAGCTCGGACGCGGTGCTGCAGCG
gtgagcccagagcccagctgctgttaactccatcccctcaagttaggcatggcttctccc
cttggtcccaggactctgtcaggagctgtcatttctctgctgggaattccatggggctat
agcaggggaggctcttggcttcctacctgtcacctactgagaacctattggcctgtcata

Exon  8 +      38491      38653   2   Internal    163    84        Good
ctgggattacaggcatgagccaccacgctcggccatccactgcgcccagcccctagccat
atttctatgctggcacatggagcagccacctctgcatagggagccccatggctgtgccat
gctgggggccattccccctggtggacggcatcggaggctcacggcactcccctcgcccag
GTTGCCAGAGGAGGCCCGCCACCGGCGTGTGTTCGAGATGGTGGAGGCACTGCAGGAGCA
CCCTCGAGACCCCAACCAGATCCTGATCGGCTACAGCCGAGGCCTCGTTGTCATCTGGGA
CCTACAGGGCAGCCGCGTGCTCTACCACTTCCTCAGCAGCCAG
gtaggcagtgcccaggacatggcaggcgccatgttgctctcccagggccccaagtggcac
atacacactgtgcagaggcatggggtgcaggcgatgggaacgccgcctcggtccagcgtg
ctgccctctgtccctctcctcttcctccatagcaactggagaacatctggtggcagcggg

Exon  9 +      38806      38942   0   Internal    137    81        Good
cgtgctctaccacttcctcagcagccaggtaggcagtgcccaggacatggcaggcgccat
gttgctctcccagggccccaagtggcacatacacactgtgcagaggcatggggtgcaggc
gatgggaacgccgcctcggtccagcgtgctgccctctgtccctctcctcttcctccatag
CAACTGGAGAACATCTGGTGGCAGCGGGACGGCCGCCTGCTCGTCAGCTGTCACTCTGAC
GGCAGCTACTGCCAGTGGCCCGTGTCCAGCGAAGCCCAGCAACCAGAGCCCCTCCGCAGC
CTCGTGCCTTACGGTCA
gtgtttcacccgccgggcagggcccacccccagtgcctcctggattcaggtgcaggttgc
tcaattctgaagcaaactccagggccagagagggtaaaggctttgtccaaagccacacag
cagggttcgcctcacccagtttcttggggaacttctcggagcaagattcccaagcacagg

Exon 10 +      39828      40017   2   Terminal    190   100   Excellent
agcctggatgccctcaccttacctccaagtcctcctgggctgtagcagttggaaggagat
ggggtccagtctcccctgctcctggggaccttgactgagtggtgactttgattgccggcc
tgtggctgttgaggctgtgccaggagccccagcccactgccgctcctctgtgcctgccag
GTTGCCCTTCACCATCTTCCAGGGTGGCATGCCACGGGCCAGCTACGGGGACCGCCACTG
CATCTCAGTGATCCACGATGGCCAGCAGACGGCCTTCGACTTCACCTCCCGTGTCATCGG
CTTCACTGTCCTCACAGAGGCAGACCCTGCAGCCAGTAGGAGAGCTTCGGGAGTGGGTGC
CCAGGGTTAG
gtgtgggaggcatggggcaggaccatcagtaaagacagggccaggtgcagtggctcctgc
ctgtaaccccagtgctgtgggaggccaaggtggtaggatcgcttgaacccaggagttcaa
gtccagcctggacaacgtagggagacccttgtctctacaaaaaataaaaaaattagccag

Exon 11 +      41654      41714   0    Initial     61    81        Good
gcagaggacagcagtgctggtttagacaagggttggcaaggcctccctgataaggggacg
tatttgcgcagacacggaagcagtctgatggaaggcttgccctgtagggacctggggtgc
agactgagctgggagggctcttggcttgctccaatgaggtaggggcgaagagagggcaga
ATGGCCCCCGTGCTGGTCCAGATGTGGCCAGCGCCAGATCGTATAGAGCCGTGGAGGCAC
G
gtaaggacttggggtttgagggagatgagggccctgagcaggggtgccatgatctagcct
ctgctccagaaggatctgtctggctgccatgtgggggacacggagtggagcaaagacggg
agcccagtgagagtcgagggagaggtgacctcagcttgggctgcggtgcaggccatggga

Exon 12 +      43951      44168   1   Internal    218    97   Excellent
agccagggctactgcccacacctgctgccctcctggagatggaaaggctttgctcaagca
gccaagaacagggctttctggatctgcagatgccctggctccaaccctggagcttctgat
tccacagagctgggctgcttcctcctggccccggcccctgacccttgccctgtaccccag
CCTTTGACGACCCCTATGCCCTGGTGGTGCTGGCTGAGGAGGAGCTGGTGGTGATTGACC
TGCAGACAGCAGGCTGGCCACCGGTCCAGCTGCCCTACCTGGCTTCTCTGCACTGTTCCG
CCATCACCTGCTCTCACCACGTCTCCAACATCCCGCTGAAGCTGTGGGAGCGGATCATTG
CCGCCGGCAGCCGGCAGAACGCACACTTCTCCACCATG
gtaggtctggccctggccccagccccagccccaccgcaagccaaactctcccatggactt
cttggtctctttttctaggagtggccaattgatggtggcaccagcctgaccccagcccca
ccccagagggacctgctgctcacagggtagggtactttgatgctaccccacctcttccca

Exon 13 +      44436      44606   0   Internal    171   100   Excellent
attgatggtggcaccagcctgaccccagccccaccccagagggacctgctgctcacaggg
tagggtactttgatgctaccccacctcttcccagtaggatatgtggggtgggagcagagc
cctgaggtggacgagccagcccctgggcatcccggctggcatccctctcacgcctggcag
GTGGGTTCTGCCCACAGGCACGAGGACGGCACGGTGCGGTTCTGGGATGCCTCGGGTGTC
TGCCTGCGGCTGCTCTACAAACTCAGCACTGTGCGCGTGTTCCTCACCGACACGGACCCC
AACGAGAACTTCAGTGCCCAGGGCGAGGACGAGTGGCCCCCACTCCGCAAG
gtgaggccaggagcctgggacccaggaagggcagaggccagctgggtcctgtccccgtgg
ctgctcacagggcccctccccttctccaggtgggctcctttgacccctacagtgatgacc
cccggctgggcatccagaagatcttcctctgcaagtacagcggctacctggctgtggcag

Exon 14 +      44696      44800   0   Internal    105   100   Excellent
actcagcactgtgcgcgtgttcctcaccgacacggaccccaacgagaacttcagtgccca
gggcgaggacgagtggcccccactccgcaaggtgaggccaggagcctgggacccaggaag
ggcagaggccagctgggtcctgtccccgtggctgctcacagggcccctccccttctccag
GTGGGCTCCTTTGACCCCTACAGTGATGACCCCCGGCTGGGCATCCAGAAGATCTTCCTC
TGCAAGTACAGCGGCTACCTGGCTGTGGCAGGCACGGCAGGGCAG
gtagcaggctgggctggggagggggagctggggaggagtggtcgatgactggggacagca
gggacaggagccaaccacctgcctaacgcacattctgtgtcctttgcttttccggtggat
ggaggtggcttgatccccttggcgggaggtccctgggatggttgtttcttctccagaaat

Exon 15 +      45438      45730   0   Internal    293    94   Excellent
acagagcaagacttgtctcaaaaaaaaaaaaaaaaaatgcaggagagctggggttggaca
gaggcctttgtccttccttgagccttgggcccagctcctttgctgtccccactagtagca
tcctgcggccctgccgtccctttgctgagggcttgctgagccacctgccaccctgcgcag
GTGCTGGTACTGGAACTGAATGACGAGGCAGCGGAGCAGGCTGTGGAGCAGGTGGAGGCC
GACCTGCTGCAGGACCAAGAGGGCTACCGCTGGAAGGGGCACGAGCGCCTGGCAGCCCGC
TCAGGGCCCGTGCGCTTTGAGCCTGGCTTTCAGCCCTTCGTGTTGGTGCAGTGTCAGCCC
CCGGCTGTGGTCACCTCCTTGGCCCTGCACTCTGAGTGGCGGCTCGTGGCCTTCGGCACC
AGCCATGGCTTTGGCCTCTTTGACCACCAGCAGCGGCGGCAGGTCTTTGTTAA
gtgagcaggggcggctgggtcccggggctgggagtggggcccgcgaggactcccaggacc
tagcagcactgacagcctgccatccccccaaggtgcacactgcaccccagtgaccagctg
gccttggagggcccactctcccgcgtcaagtccctcaagaagtccttgcgtcagtcattc

Exon 16 +      45841      45973   2   Internal    133    71        Good
tcgtggccttcggcaccagccatggctttggcctctttgaccaccagcagcggcggcagg
tctttgttaagtgagcaggggcggctgggtcccggggctgggagtggggcccgcgaggac
tcccaggacctagcagcactgacagcctgccatccccccaaggtgcacactgcaccccag
TGACCAGCTGGCCTTGGAGGGCCCACTCTCCCGCGTCAAGTCCCTCAAGAAGTCCTTGCG
TCAGTCATTCCGCCGGATGCGTCGGAGCCGGGTGTCCAGCCGGAAGCGGCACCCGGCTGG
CCCCCCAGGAGAG
gtgaggcctgaggtgaggctgcggccggccacgcacccaggttcggctcagagcagccag
caggggggccacacggcccctgctccccaggcttgctaggctacaaacaagattcagggt
ccaggtcgcattgtgtgacctcagacaggtcacgctgcttctctctgcctcagcttcctg

Exon 17 +      46425      46575   0   Internal    151   100   Excellent
cccaggcaggctcccccaagggcacctccctcttggacaagggtccctctagacgcaggc
ctggcaggtggctggcatggctgtggcctgccttccgatgcaaggatcagcactgagcga
agcactgttcctggggaggggagtccagagctgacccttaggctggcccaccccttgcag
GCACAGGAGGGGAGTGCCAAGGCTGAGCGGCCAGGCCTCCAGAACATGGAGCTGGCGCCT
GTGCAGCGCAAGATCGAGGCTCGCTCGGCAGAGGACTCCTTCACAGGCTTCGTCCGGACC
CTGTACTTTGCTGACACCTACCTGAAGGACA
gtgagtggccagcctggggttggggggcagggggtagtgggcagcagacaccccctgacc
tgggggcatgccgggggctgctgcctgcctggctggtaggagctaagaggtttccccttg
tgagcaggggcagactgcagcccctgcctgcttactcccctcccctgcctcagcctctga

Exon 18 +      47142      47242   1   Internal    101    75        Good
tgtatcacagcaagggctgagctgacctgggattggggtcttctatgttggggcctgtgt
ggttgtcagagagccttccagcctctcccaggagggaaaacctgggagtaaaccctggtt
gcccagctccacccgactcccacgctaagggtcagacacccaaacatggcttctcggcag
GCTCCCGGCACTGCCCCTCGCTGTGGGCTGGCACCAATGGGGGCACCATCTATGCCTTCT
CCCTGCGTGTGCCTCCCGCCGAGCGGAGAATGGATGAGCCT
gtgcgggcagagcagggtgagtgctgggcagggagagcagagggtgctcgggctgcctgg
gctgggtccagggagtggctccagccctgccaccccctcaccagccccaacacccacctc
ctccccctagccaaggagatccagctgatgcaccgggcgccggtggtgggcatcctggtg

Exon 19 +      47373      47560   1   Internal    188    90   Excellent
atgccttctccctgcgtgtgcctcccgccgagcggagaatggatgagcctgtgcgggcag
agcagggtgagtgctgggcagggagagcagagggtgctcgggctgcctgggctgggtcca
gggagtggctccagccctgccaccccctcaccagccccaacacccacctcctccccctag
CCAAGGAGATCCAGCTGATGCACCGGGCGCCGGTGGTGGGCATCCTGGTGCTCGACGGAC
ACAGCGTACCCCTTCCCGAGCCCCTCGAAGTGGCCCATGATCTGTCGAAGAGCCCTGACA
TGCAGGGAAGCCACCAGCTGCTCGTCGTATCAGAGGAGCAGTTCAAGGTGCCACACGGGC
AGCGGCGG
gtctccctgggactccccgggacatccaggaggctcggaccttgggcaaaaatgatggct
gggactcagtcttgtttgcagttggtgtctgaggggctgcagaagtacaggaaataagtg
aggggggagtctcgtgtgaggacactgaggcaggacagggggccaggcgcggtgactcat

Exon 20 +      48489      48753   0   Internal    265   100   Excellent
aaaatccagatagggaagtcggtgacctcggcatcctcccaggccatgtctgtgcatctg
agagccaagggtttgtcaggacaccgggaggcatgtggggaggggagggcccagcagcag
cagcacagggcaggagaactggtttggccatgggcatgaacaaccaccccacgcccccag
GTGTTCACGCTGCCCAAGGTGAGTGCCAAGCTGAAGTTGAAGCTGACGGCCCTGGAGGGC
TCAAGAGTGCGGCGGGTCAGCGTGGCCCACTTCGGCAGTCGTCGAGCCGAGGACTACGGG
GAGCACCACCTGGCAGTCCTTACCAACCTGGGCGACATCCAGGTGGTCTCGCTGCCCCTG
CTCAAGCCCCAGGTGCGCTACAGCTGCATCCGCCGGGAGGACGTCAGTGGCATCGCCTCC
TGCGTCTTCACCAAATATGGCCAAG
gtgtttgagccgggctgggtgggtgtcggggccccgggcactgcacggacgggaagggtg
gccaggggtgttgtggccacggccagactggatgggccttaagcggagaactgcgaggga
gcactagcccctactcccccaggtggggaggcagccttggcagccgccaggccaggccgc

Exon 21 +      48956      49106   1   Internal    151   100   Excellent
gtgtcggggccccgggcactgcacggacgggaagggtggccaggggtgttgtggccacgg
ccagactggatgggccttaagcggagaactgcgagggagcactagcccctactcccccag
gtggggaggcagccttggcagccgccaggccaggccgctagcattgcccccactccccag
GCTTCTACCTGATCTCACCCTCGGAGTTTGAGCGCTTCTCTCTCTCCACCAAGTGGCTGG
TGGAGCCCCGGTGTCTGGTGGATTCAGCAGAAACCAAGAACCACCGCCCTGGTAACGGTG
CGGGCCCCAAGAAGGCCCCGAGCCGAGCCAG
gtgagtgaaagggccagaggcctctcccgcccctcccgcccctccctgccctctctgaga
taccgaggctcccactgctgcctggctggaggcacctccccacgagctcagcccaccctc
ccaggctccggctctccttgcctctttgcgtgccccttgcccctgtgcaagctggcagtc

Exon 22 +      49427      49455   2   Internal     29    53    Marginal
cctctttgcgtgccccttgcccctgtgcaagctggcagtccagggcaggactcagtttac
ctcccaggctctccggctcaggacaggctgcgccattgacttgttcttcatgggaccagg
gctctcagagccgggcagggagcccgggggccctggtcctcactgtctcttcccccacag
GAACTCAGGGACTCAGAGTGATGGCGAGG
gtaagacaggcctcctgggctcatgcacacctgggccacacccggcccagacctggggct
ggacgggagggaagggtcccgagtgagcaggtagtgtttgggctgggaatagagacggca
ttccttccagccctgggccctgggcttccacatcctgacctcagtaaggagagagagagc

Exon 23 +      49688      49735   1   Internal     48   100   Excellent
ctggggctggacgggagggaagggtcccgagtgagcaggtagtgtttgggctgggaatag
agacggcattccttccagccctgggccctgggcttccacatcctgacctcagtaaggaga
gagagagccaggccgaggagggcccaggcggggcgccctgacccggcctctaccttccag
AGAAGCAGCCCGGCCTGGTGATGGAGCGCGCTCTGCTCAGTGATGAGA
gtgagttgggtgggagagggtggggctggcaggaggggtggggaaggggggtcagggtca
agggaggctgggcaggccactgccctgaggcggggtacagatccatgggcacccacggag
aaagggggtggaagggctgtggctagccgccccaagggcctcagtgggcctctgttccca

Exon 24 +      49928      49970   1   Internal     43   100   Excellent
ggagagggtggggctggcaggaggggtggggaaggggggtcagggtcaagggaggctggg
caggccactgccctgaggcggggtacagatccatgggcacccacggagaaagggggtgga
agggctgtggctagccgccccaagggcctcagtgggcctctgttcccacccggcctgcag
GAGTCCTGAAGGAAATCCAGAGCACACTGGAGGGAGACCGCGG
gtgaggcaccgcccaggccagctggggtgggcccgaggctctgccagagggctcagggga
gcgctgagagtggaggtccctgaggccatgactcccctgtctttgcctgtgcaggagcgg
caactggcgttcacatcgagccgccgtggggtgcagcctcagcaatggcggaggtggggg

Exon 25 +      50085      50317   1   Terminal    233    56    Marginal
ctctgttcccacccggcctgcaggagtcctgaaggaaatccagagcacactggagggaga
ccgcgggtgaggcaccgcccaggccagctggggtgggcccgaggctctgccagagggctc
aggggagcgctgagagtggaggtccctgaggccatgactcccctgtctttgcctgtgcag
GAGCGGCAACTGGCGTTCACATCGAGCCGCCGTGGGGTGCAGCCTCAGCAATGGCGGAGG
TGGGGGCTCTGGGCTTGAGTGCAGCTGCCAACCGTGCTGGGAAGGGCTGGGAGGAAGAGC
CCCGGCCCCACTCCCCTGGGTCCCACGGGGCTGACACGTGCCCTGATGACCAGGAAAGCA
CCATGTCTGGGCTCAGCGTGGGCGGCTGGGGCACCCCGTCCTGCCCAGGGTGA
tcttgagctgtccctctgtgtccttcagcagagtgagtggctgagcgtccaggctgcgcg
atgagcacacactactactgatggcctttcgggggtccctgccccaaccggagaggccgg
tgcacagggccccgccaggggctgggggcatcccggcttccacaatgcagctgctctggg

--------------------------------------------------------------------------------