--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (54047 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (10 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1276       1344   0    Initial     69    86        Good
cccctcctccccgctgtgtttattaggggaaggagggcggaggcggaggccagttcccca
gctccagccgccgtcgctgctgcctgtgtagttgcagccgcggccgcctcccgccagctc
gcctcggggaacaggacgcgcgtgagctcaggcgtccccgccccagcttttctcggaacc
ATGAACCCCAACTGCGCCCGGTGCGGCAAGATCGTGTATCCCACGGAGAAGGTGAACTGT
CTGGATAAG
gtgagcccgggaccgggagacgcgtctttgcaatcccccgcagtgctccgaatccaggga
ggagagaagggccgggtctttgccgccttatccccgcgatcccaggagaatggagggagg
gcgagcgggcggtgtcatggggtgtggggacacatcccagtctgaaaaccaggagatctg

Exon  2 +       9172       9266   0   Internal     95    98   Excellent
ggggagtgccaaagcctgtgacctgaaatgcccccagctcacctgggatgattccatgtt
ctccccacagccatgggcctaggacagtcccagcagctcctgagtgccccttcctagggc
ctgagcccctttttcagaagtcctggtatctgatgtatgtcctcctgtctccatccccag
TTCTGGCATAAAGCATGCTTCCATTGCGAGACCTGCAAGATGACACTGAACATGAAGAAC
TACAAGGGCTACGAGAAGAAGCCCTACTGCAACGC
gtgagtcctgttctgggcagggggctgggtgggcaccttggctccctccccgagtgagtt
cttcctttccttccaataaccgcaaggtgacattggcgaacacttccatcccctacttga
acatcacagtttgtcctcacaacagctgaatgaagcaagcactttttatccccatttaaa

Exon  3 +      16524      16605   0   Internal     82    52    Marginal
tttcttcatctgtaaaacggcacaatgagaatgccagcctaaagctgtgtggtgggtttt
gagagagaatgtgcacaggactcagtgtgccaagatgttgctttgtgtctctgtaaattg
tcctgaagcccgaggctgctgccaatagctgcctgtttgccctgccctatccctgtccag
TCCCTGTTCCTGCCCCGCTTCTTCCTGTCCTACATGCCTCTCCCTGCAAACTCCCCAGAG
CAGCTGATAGCAGGGAGGAAGG
gtgggtggggcacctgcagagagcccaccacccacttggaatgattaacaaggggccagt
acaggctggcctatgggacaaaggacagctgtgctctggactctgccctgcacccagctg
atcacctgtccctcattcctcgccatggcccagtctgtcatggggttgggttccagcgga

Exon  4 +      21506      21590   2   Internal     85   100   Excellent
tctgagaaacgcttgtctcccctcggccttggtggtggacactgaagtcctcctgtgggg
ccgggccagggcgtgcccaagcataggacgaagttcccaggagggcatgctctgtgagaa
gcccagaggctcctgcccctcccccagagtcacccccactctgttttttctgtcctgcag
ACACTACCCCAAGCAGTCCTTCACCATGGTGGCGGACACCCCGGAAAACCTTCGCCTCAA
GCAACAGAGTGAGCTCCAGAGTCAG
gtgaggggctgggcggtgctggggcctggcagggagggatgctggggagggaagttgtaa
ggtcggcatttggcaagagtaccttcccctgcggttactctgcaaggccaaggtgctgaa
atcctagcattgcctttaatcttgaccccacccctgactttatcaaaggagcagggtaga

Exon  5 +      24196      24354   0   Internal    159    85        Good
actgagggccagagcgtgtccgtgtgtgtatgtgtgtgtgtgtgcgtgtgcacgcatgca
cgcgtgtatgtgtgtgtgtgtgtgtgcaagcatgcacgcatgtatgcgtgtatgcctgac
tttgtttaatccttacagccacctgatgaaagaggggctcttattatccccatcatacag
ATAGGGAAACTGAGGTTTACAGAGGCTGCCCTGCTTGTGCAGAGCCCAGGGACAGGGGCA
GACATCAAGTCCCATGACCTGGCCCTGGAGCCCGTTGCTCTGAACAGTGCTGATGGCACA
GGCACCGAGCCCTGTGCTCCCACCCTGCAGGATGCACCA
gtcagcagcaagtaggatgggcttgttggaatgcagattcctaggccccacccaagggac
ttctgcttggcagctctgggtgaggcccaagaatctgcattttgactcccccgtgattct
gataaggacttttggccccactttaagaagcttagagatgggtccatgggcaggagtgta

Exon  6 +      29498      29605   0   Internal    108   100   Excellent
tattacgagtctaacaccttttggctgaggcctctgctttgagttggggacttctgatca
gggtctttctgctgactccctgtccctgtctcctgactggttgctgcctcagaggggccc
caagccgaggccctttcggctcctggcctgactccaatccctcttcctcccctcctgcag
GTGCGCTACAAGGAGGAGTTTGAGAAGAACAAGGGCAAAGGTTTCAGCGTAGTGGCAGAC
ACGCCCGAGCTCCAGAGAATCAAGAAGACCCAGGACCAGATCAGTAAC
gtgagctcttgccctgccctgcggcatccctgctgccctctgtttggtccccttcctgcc
agcctggcagacgcaagcctggcagatgtgaatgaggccagtgcctccactacccctgcc
ctccagggtgggcctggggaagagcttggggttcccagatgcctcttctctgtgtacccc

Exon  7 +      29498      29755   0   Internal    258    82        Good
tattacgagtctaacaccttttggctgaggcctctgctttgagttggggacttctgatca
gggtctttctgctgactccctgtccctgtctcctgactggttgctgcctcagaggggccc
caagccgaggccctttcggctcctggcctgactccaatccctcttcctcccctcctgcag
GTGCGCTACAAGGAGGAGTTTGAGAAGAACAAGGGCAAAGGTTTCAGCGTAGTGGCAGAC
ACGCCCGAGCTCCAGAGAATCAAGAAGACCCAGGACCAGATCAGTAACGTGAGCTCTTGC
CCTGCCCTGCGGCATCCCTGCTGCCCTCTGTTTGGTCCCCTTCCTGCCAGCCTGGCAGAC
GCAAGCCTGGCAGATGTGAATGAGGCCAGTGCCTCCACTACCCCTGCCCTCCAGGGTGGG
CCTGGGGAAGAGCTTGGG
gttcccagatgcctcttctctgtgtacccccagaccaccagcacgcatagcattttcttc
ttgaagggactgtattctgtgggggcctgtgtgctaaatcagcccccactctctctgact
gttgttcttttttctggatatcgtgggtatcggtgaagactgcatgtctcatcttagcac

Exon  8 +      45411      45561   0   Internal    151   100   Excellent
ggcttggcaagattaggtagcttgtccaaggacacacagctggtgcttccagagcgagac
ctggctttctgtacccaaagctcttgggtagtctctcccatcctgggatcttgagggtca
cgggaaggaactgggtggtttgcagtgggacccttcacctagtgccttctgaccttgcag
ATAAAATACCATGAGGAGTTTGAGAAGAGCCGCATGGGCCCTAGCGGGGGCGAGGGCATG
GAGCCAGAGCGTCGGGATTCACAGGACGGCAGCAGCTACCGGCGGCCCCTGGAGCAGCAG
CAGCCTCACCACATCCCGACCAGTGCCCCGG
gtgagtgcaggtcctgttggtgcagatgacctgaggcgaggccagtggggtggggaggaa
gccaggagaagacagacagacagatacaccttccggagccttgctcttaatcaacaggcg
attatgcctcttgtgtgcaagaggggaccagaggacctgaggccgggccagctggggtgg

Exon  9 +      46129      46232   1   Internal    104   100   Excellent
cccctgcgtgggatacaacacacaggcaaatgtgcacacgtggacatcagcctttgagct
gtggggcttgagccaggttgggggcggggtggaagtgcatggtatggacttctcgggagc
tctgggaggggctgggtttggcaggacagtttccaagccctgtctcctcccatcttccag
TTTACCAGCAGCCCCAGCAGCAGCCGGTGGCCCAGTCCTATGGTGGCTACAAGGAGCCTG
CAGCCCCAGTCTCCATACAGCGCAGCGCCCCAGGTGGTGGCGGG
gtgagtaaccctggccggaggggagaggccagaggcagggggtccttcgggaaggcttgg
acacagctcatggattctcctgacctttgcacccaccctctgttgtgtgtgatgataagg
atctcagccttgtgagcagagaggaaattggttggcgtagtgggcagaggctggctggga

Exon 10 +      49691      49864   0   Terminal    174    99   Excellent
gattgctctcagaaagcaagacacagaggttaagaatctttgcagcagagcctggtgctc
catttctgagttcactgctcccccaggctctgctccagggtcgtggagagttagaaaaaa
atgctcagacccaggtgagccggcatgcagggccctaggctgaccacacttcccccacag
AAGCGGTACCGCGCGGTGTATGACTACAGCGCCGCCGACGAGGACGAGGTCTCCTTCCAG
GACGGGGACACCATCGTCAACGTGCAGCAGATCGACGACGGCTGGATGTACGGGACGGTG
GAGCGCACCGGCGACACGGGGATGCTGCCGGCCAACTACGTGGAGGCCATCTGA
acccgcagcgcccccatctgtcttcagcacattccacggcatcgcatccgtcctgggcgt
gacccgtccattcttcagtgtctctgttttttaaaacctgcgacagcttgtgattcctac
ccctcttccagcttcttttgccaactgaagccttcttctgccacttctgcgggctccctc

--------------------------------------------------------------------------------