--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (8307 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (7 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1609       1791   0    Initial    183    63    Marginal
tttgggggtggctccggaagttccatggcaggaggactgggtgctggttatgggagagcc
ctgggtggaggtagctttggagggctggggatgggatttgggggcagcccaggaggtggc
tctctaggtattctctcgggcaatgatggaggccttctttctggatcagaaaaagaaact
ATGCAAAATCTTAATGATAGATTAGCTTCCTACCTGGATAAGGTGCGAGCTCTAGAAGAG
GCTAATACTGAGCTAGAAAATAAAATTCGAGAATGGTATGAAACACGAGGAACTGGGACT
GCAGATGCTTCACAGAGCGATTACAGCAAATATTATCCACTGATTGAAGACCTCAGGAAT
AAG
gtaagatctcttttggaggcgctttgggaattttttttttcctttttaccattacaatgt
tttacagtgataatcacctacaactttgatattttccaatttagctgtacttgcagcaat
tttctcatcccaggttgtttcactccactttatcatttactaagaaatgattgtatttcc

Exon  2 +       2174       2260   0   Terminal     87    87        Good
gcatttctttacttctcaatattattttatacagatattgtcttagaaaaatgaaactgt
cttaaactctaaataaaacagcatttaatatcaccattttcacctttgtgtcaaaaatat
atttgtataatactagtcttttagggcttcaatcttgtgtgtgtccctctcttttgccag
ATCATTTCAGCCAGCATTGGAAATGCCCAGCTCCTCTTGCAGATTGACAATGCGAGACTA
GCTGCTGAGGACTTCAGGATGAAGTGA
gtcgaataaactgaagatcatgggcgtgtcccaccatgtcttctgtcctactgtcctgcc
ttcattgatataaaatcttctgaagttcacatactccatatatttactgttttggtaaat
tcacatagggtgttctagaaagtaattagaatctaatgcaattcagattaaatgtcctta

Exon  3 +       3449       3605   2   Internal    157   100   Excellent
agtaaacaatggtgggaaaaaaggaaaggaaaaacacaacagcaaaaactgcatcataca
ctacaatgctgccattattaagtaggtgcacagatttaagcaagaaatagccctgaagat
cagtggccttgttcaaatggttgtgttgattccctcaactgctttgcacttggttttcag
GTATGAGAATGAACTGGCCCTGCGCCAGGGCGTAGAGGCCGACATCAATGGCCTGCGCCG
GGTGCTGGACGAGCTGACCCTGACCAGGACCGACCTGGAGATGCAGATCGAGAGCCTGAA
CGAGGAGCTGGCCTACATGAAGAAGAACCACGAGGAT
gtgagtcagacagggcagcctcactcagctacttttttttttctcccagacccaaaaatt
acaatttcaaatttagaaatctggagtcaggacaagtatggagaatacattgtctccctg
ttaaaatggccatttgttttagatttctgtgtgatgtgtgtggtatgtgtgtgtgtgatg

Exon  4 +       4547       4708   0   Internal    162    93   Excellent
attacattaatatatttgtctttataccaacagtcataagatagaatttttaagtgtgtg
tgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtaggaaggggcccaagaggacaaaagtatc
cagggcccacgaaagtcacaatggacccctgtgcccctctctctcacatgctgtccccag
GAGCTCCAAAGCTTCCGGGTGGGCGGCCCAGGCGAGGTCAGCGTAGAAATGGACGCTGCC
CCCGGAGTGGACCTCACCAGGCTCCTCAATGATATGCGGGCGCAGTATGAAACCATCGCT
GAGCAGAATCGGAAGGACGCTGAAGCCTGGTTCATTGAAAAG
gtaacacaaacaacaaaggctttgatacattcacagaaaggcctgcgaacgagctcagcg
ctcgagccccctggctgtctttgctgttgcagagcggggagctccgtaaggagattagca
ccaacaccgagcagcttcagtccagcaagagcgaggtcaccgacctgcgtcgcgcctttc

Exon  5 +       4801       4926   0   Internal    126    97   Excellent
caccaggctcctcaatgatatgcgggcgcagtatgaaaccatcgctgagcagaatcggaa
ggacgctgaagcctggttcattgaaaaggtaacacaaacaacaaaggctttgatacattc
acagaaaggcctgcgaacgagctcagcgctcgagccccctggctgtctttgctgttgcag
AGCGGGGAGCTCCGTAAGGAGATTAGCACCAACACCGAGCAGCTTCAGTCCAGCAAGAGC
GAGGTCACCGACCTGCGTCGCGCCTTTCAGAACCTGGAGATCGAGCTACAGTCCCAGCTC
GCCATG
gtaggctcgtgcgcaaacagacgtagcatcctttggacttccaaagaaaatgctgcatcc
aaattacattagccgttggctaccctcctcttttcggtcccctccatcgttatttctatg
ccatttccctcccacgtgcagaagaaatccctggaggactccttggccgaagccgagggc

Exon  6 +       5068       5288   0   Internal    221   100   Excellent
cagaacctggagatcgagctacagtcccagctcgccatggtaggctcgtgcgcaaacaga
cgtagcatcctttggacttccaaagaaaatgctgcatccaaattacattagccgttggct
accctcctcttttcggtcccctccatcgttatttctatgccatttccctcccacgtgcag
AAGAAATCCCTGGAGGACTCCTTGGCCGAAGCCGAGGGCGATTACTGCGCGCAGCTGTCC
CAGGTGCAGCAGCTCATCAGCAACCTGGAGGCACAGCTGCTCCAGGTGCGCGCGGACGCA
GAGCGCCAGAACGTGGACCACCAGCGGCTGCTGAATGTCAAGGCCCGCCTGGAGCTGGAG
ATTGAGACCTACCGCCGCCTGCTGGACGGGGAGGCCCAAGG
gtgagcagacaacggaggctgtaaacaccttcaggggctgaccaagagtgggcagcagaa
atagaaggaatggggttttagttgacagaaaagcaaacaaacaaacacaagtctagtaaa
gatatgcctgggatttactaaatgctctacactttgcaaagtgttttcacccattatctt

Exon  7 +       6653       6750   1   Terminal     98    94   Excellent
gaatacatttcattgtcattggctaaaacacatttttgagaagtaaaatttacttttgaa
agtttaattagatggattgtatcaaccaatgcttaatttagaagcctacattaaacaacc
agtgttggattaatatttgaaacactaactcttgcccccttattccatttttatctttag
ACCCAACCAAAACCCGAAAAATCAAGACAGTTGTGCAGGAGATGGTGAATGGTGAGGTGG
TCTCATCTCAAGTTCAGGAAATTGAAGAACTAATGTAA
aatttcacaagatctgccccatgattggttccttaggaacaagaaatttacaagtagaaa
ttattcctttcagagtaacatgctgtattacttcaatccctatttttgtctgttccattt
tctttggattccctattcacattgaatcctttttgcccttctgaaacaatattcagtcac

--------------------------------------------------------------------------------