--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (14971 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (5 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1292       1509   0    Initial    218    80        Good
aaacgtggtttttgagtccaaagatcagggctgggttgacctgaatactggatacagggc
atataaaacaggggcaaggcacagactcatagcagagcaatcaccaccaagcctggaata
actgcaagggctctgctgacatcttcctgaggtgccaaggaaatgaggatggaggaagga
ATGAATGTTCTCCATGACTTTGGGATCCAGTCAACACATTACCTCCAGGTGAATTACCAA
GACTCCCAGGACTGGTTCATCTTGGTGTCCGTGATCGCAGACCTCAGGAATGCCTTCTAC
GTCCTCTTCCCCATCTGGTTCCATCTTCAGGAAGCTGTGGGCATTAAACTCCTTTGGGTA
GCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTG
gtaagaaccatatagagaggagatcagcaagaaaagaggctggcattcgctctcgcaatg
tctgtccatcagaagttgctttccccaggctattcaggaagccacgggctactcatgctt
ccaacccctctctctgactttggatcatctacataaagggggaagacagaaaaaatccta

Exon  2 +       4334       4443   2   Internal    110    97   Excellent
ttacatacataaggaagtgtcatgaaatatctccctctcacacttctccccagccaccca
gttctcccttctagaggcaacatgtgaaatccttctcaggctacactcttcttgaaggtg
taggctttgggcaaaagcattcattcagtaaccccagaaacttgttctgtttttccatag
GATTCTCTTTGGACAGCGTCCATACTGGTGGGTTTTGGATACTGACTACTACAGCAACAC
TTCCGTGCCCCTGATAAAGCAGTTCCCTGTAACCTGTGAGACTGGACCAG
gtaagcgtcccagcccctgcagacagaagctgagtggacctcgtttacctgttatggatg
aaactgaccttgaggggacatgaggagagccattcctttgtacttttgtcatgctcttca
attggcacaaattaattcacttctgcaatactttcctgaatagcacagtagtattggaaa

Exon  3 +       7926       8031   1   Internal    106    98   Excellent
aacgaatggatggtaagatgggtggatggatggggggtgaacggatggatggggggtgaa
tggatggatgaatgggtagatgggtggatagggggatggctgggtggctgggtagatgat
gcactgtctcccagatgaggaccttttcacctttactccattctctttcctgccctttag
GGAGCCCCTCTGGCCATGCCATGGGCACAGCAGGTGTATACTACGTGATGGTCACATCTA
CTCTTTCCATCTTTCAGGGAAAGATAAAGCCGACCTACAGATTTCG
gtaagaactcaccactggggtgtaggtggtggagggcaggaggcagctctctctgtagct
gacacaccacgtattcttcctcacatccccctagcccgctcccacacctgggcagccgct
gattaagagttgtggcactttggatagggataaacctcagagtcagggaatgtttgggct

Exon  4 +       9706       9821   2   Internal    116    76        Good
tctgagccgctgcacccagcccccaacaggcatctttggacttttgagtactggctttaa
tttacaaaaattccactgagagcacctaagtttgccaggctccaacatttctgcaggggc
tgttttctttgctgaaggatctgcacctgtgttctgttatggttgcctcttctgttgcag
GTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGGCTGTGCAGCTGAATGTCTGTCTGTC
ACGAATCTACCTTGCTGCTCATTTTCCTCATCAAGTTGTTGCTGGAGTCCTGTCAG
gtatgggctgatctgactcccttccttctcccccaaaccccattccgtttctctccctaa
tcaggacaaaatcccagcattccagccacatcctgtgtgtaatcagtactgttagcattt
ctgtgggttgaaagtcaagaatgagcaacttgaaatgattaatttctataagagtgccca

Exon  5 +      11318      11829   1   Terminal    512    85        Good
tatattgagggcaggctggagtcacacatgggaataagccaggcgaccctcccatctgcc
atctgtgatttaattccacagtcgcagaacggatggcatgtcacccactcctccaaaccc
acctctagcaaaggtcccaaatccttcctatctctcacagtcatgctttcttccactcag
GCATTGCTGTTGCAGAAACTTTCAGCCACATCCACAGCATCTATAATGCCAGCCTCAAGA
AATATTTTCTCATTACCTTCTTCCTGTTCAGCTTCGCCATCGGATTTTATCTGCTGCTCA
AGGGACTGGGTGTAGACCTCCTGTGGACTCTGGAGAAAGCCCAGAGGTGGTGCGAGCAGC
CAGAATGGGTCCACATTGACACCACACCCTTTGCCAGCCTCCTCAAGAACCTGGGCACGC
TCTTTGGCCTGGGGCTGGCTCTCAACTCCAGCATGTACAGGGAGAGCTGCAAGGGGAAAC
TCAGCAAGTGGCTCCCATTCCGCCTCAGCTCTATTGTAGCCTCCCTCGTCCTCCTGCACG
TCTTTGACTCCTTGAAACCCCCATCCCAAGTCGAGCTGGTCTTCTACGTCTTGTCCTTCT
GCAAGAGTGCGGTAGTGCCCCTGGCATCCGTCAGTGTCATCCCCTACTGCCTCGCCCAGG
TCCTGGGCCAGCCGCACAAGAAGTCGTTGTAA
gagatgtggagtcttcggtgtttaaagtcaacaaccatgccagggattgaggaggactac
tatttgaagcaatgggcactggtatttggagcaagtgacatgccatccattctgccgtcg
tggaattaaatcacggatggcagattggagggtcgcctggcttattcccatgtgtgactc

--------------------------------------------------------------------------------