--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (7381 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (7 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1803       1990   0    Initial    188    98   Excellent
gtcgtagagggcagaatgaacaagaagaattaggagggaggctgcgtgtgccggggctag
gggctggaagtcctggctctagttgcacctcggaaggaaaaggcaaacagaggagggaag
gcgtcttaggactgcctggatccagagcactttccacggcctctacaggcctgtgtcgct
ATGGGTTCCCCCGCCGCCCCGGAGGGAGCGCTGGGCTACGTCCGCGAGTTCACTCGCCAC
TCCTCCGACGTGCTGGGCAACCTCAACGAGCTGCGCCTGCGCGGGATCCTCACTGACGTC
ACGCTGCTGGTTGGCGGGCAACCCCTCAGAGCACACAAGGCAGTTCTCATCGCCTGCAGG
TTCGAGGG
gtggggcctggggcggggccaaatgggaaaggggtgggaccacagggccgttgagaggga
atccgaagccaagtctttcagaagcaggaggcggagcgtcccagaattgggggcggggtg
atagtgaggaggcgggactttttcagggggcggggcttcctgaagctgcgcatgtctccc

Exon  2 +       2214       2435   2   Internal    222    74        Good
agggccgttgagagggaatccgaagccaagtctttcagaagcaggaggcggagcgtccca
gaattgggggcggggtgatagtgaggaggcgggactttttcagggggcggggcttcctga
agctgcgcatgtctcccttggttccccagcccccaaaggacttatctgctctctctctag
TGGCTTCTTCTATTCAATTTTCCGGGGCCGTGCGGGAGTCGGGGTGGACGTGCTCTCTCT
GCCCGGGGGTCCCGAAGCGAGAGGCTTCGCCCCTCTATTGGACTTCATGTACACTTCGCG
CCTGCGCCTCTCTCCAGCCACTGCACCAGCAGTCCTAGCGGCCGCCACCTATTTGCAGAT
GGAGCACGTGGTCCAGGCATGCCACCGCTTCATCCAGGCCAG
gtgagggaccctggctcggcgttctctgtgggtgaggtgttaagggcaaaggcagagttt
aggaaatggcactaacgttcatcacactttccccagctatgaacctctgggcatctccct
gcgccccctggaagcagaacccccaacacccccaacggcccctccaccaggtagtcccag

Exon  3 +       2532       2907   2   Terminal    376    48    Marginal
cactgcaccagcagtcctagcggccgccacctatttgcagatggagcacgtggtccaggc
atgccaccgcttcatccaggccaggtgagggaccctggctcggcgttctctgtgggtgag
gtgttaagggcaaaggcagagtttaggaaatggcactaacgttcatcacactttccccag
CTATGAACCTCTGGGCATCTCCCTGCGCCCCCTGGAAGCAGAACCCCCAACACCCCCAAC
GGCCCCTCCACCAGGTAGTCCCAGGCGCTCCGAAGGACACCCAGACCCACCTACTGAATC
TCGAAGCTGCAGTCAAGGCCCCCCCAGTCCAGCCAGCCCTGACCCCAAGGCCTGCAACTG
GAAAAAGTACAAGTACATCGTGCTAAACTCTCAGGCCTCCCAAGCAGGGAGCCTGGTCGG
GGAGAGAAGTTCTGGTCAACCTTGCCCCCAAGCCAGGCTCCCCAGTGGAGACGAGGCCTC
CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGTGAAGAAGGACCCATTCCTGGTCCCCAGAG
CAGGTACAGAGTCTAG
aacctcaagaatttgtcagagctggcctcagctagaagacagagtcattgggccttgatg
gtcaggaggaagggagataggtggtgggtttcagagacactagctcaccttaaggagctg
gccagagaccaggtttattcagcagggtggcacttgggcagtacaatggatgtggctcat

Exon  4 +       3283       3331   2   Internal     49    91   Excellent
gctcaccctgagagggcaggcctttggctccaaatttcccaggagagaacccccacccct
caaccgtacaatctcttttaaccctttccttgccatctgcctaggctctctccaactgct
gccactgtgcagttcaaatgtggggctccagccagtaccccctacctcctcacatcccag
GCTCAAGACACCTCTGGATCACCCTCTGAACGGGCTCGTCCACTACCGG
gtaagagcccctctttcttggcttttctcccgtgactgctccaggcaagtttgtgccaaa
aactctcccagaaaggcctattccaatggttcctaaactttattacaaattagaatcacc
taggaagcttttaaactcccactgcccaggtcacactccatagattaaaatatctggaca

Exon  5 +       4588       4752   1   Internal    165   100   Excellent
gtcagatctggctcatcttactatcttcttacttggccttgagcaagtcaaaccagcccc
agaagtcttaacaataaattgggaaacagaaagcctgctactgtgtggtttgaggattca
gtagtacctagatagccctcattaataactatggttgccgtcacccattccccttcccag
GAAGTGAATTTTTCAGCTGCCAGAACTGTGAGGCTGTGGCAGGGTGCTCATCGGGGCTGG
ACTCCTTGGTTCCTGGGGACGAAGACAAACCCTATAAGTGTCAGCTGTGCCGGTCTTCGT
TCCGCTACAAGGGCAACCTTGCCAGTCATCGTACAGTGCACACAG
gtaggggaagagagggccctggccttcaagcccacagctgtcctagggcaaagtccctga
tctcccatgttctctgcctccaggggaaaagccttaccactgctcaatctgcggagcccg
ttttaaccggccagcaaacctgaaaacgcacagccgcatccattcgggagagaagccgta

Exon  6 +       4836       4966   1   Internal    131    95   Excellent
gttcctggggacgaagacaaaccctataagtgtcagctgtgccggtcttcgttccgctac
aagggcaaccttgccagtcatcgtacagtgcacacaggtaggggaagagagggccctggc
cttcaagcccacagctgtcctagggcaaagtccctgatctcccatgttctctgcctccag
GGGAAAAGCCTTACCACTGCTCAATCTGCGGAGCCCGTTTTAACCGGCCAGCAAACCTGA
AAACGCACAGCCGCATCCATTCGGGAGAGAAGCCGTATAAGTGTGAGACGTGCGGCTCGC
GCTTTGTACAG
gtacggagccagcctccaagtggcttccaaggcaaacctgcaagaggtggggtgggccaa
tagggagggttctgttcctcccagaggcaggacttgaagtctcctccctcccaggtggca
catctgcgggcgcacgtgctgatccacaccggggagaagccctacccttgccctacctgc

Exon  7 +       5081       5311   0   Terminal    231    99   Excellent
cacagccgcatccattcgggagagaagccgtataagtgtgagacgtgcggctcgcgcttt
gtacaggtacggagccagcctccaagtggcttccaaggcaaacctgcaagaggtggggtg
ggccaatagggagggttctgttcctcccagaggcaggacttgaagtctcctccctcccag
GTGGCACATCTGCGGGCGCACGTGCTGATCCACACCGGGGAGAAGCCCTACCCTTGCCCT
ACCTGCGGAACCCGCTTCCGCCACCTGCAGACCCTCAAGAGCCACGTTCGCATCCACACC
GGAGAGAAGCCTTACCACGTGGGTACCCAACCTGGCCTGCCCACTGCCTTAGAATTACCT
CTCCTTTGCCTAGGGGTGGGCTCTGAGAGGTGCGGGCCTGGCTGTCCCTAG
atctcttagaaatgagcggtggccggaagagtccaagcaaataaggggtggaggctggga
gtcaggatgggcaggtatagaagtgatgctcctgggctgagcactgttttctcagagagg
agctgagaagtgggaaaacctttgctaaataaggcggggcctatcccctcagccacccct

--------------------------------------------------------------------------------