--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (31583 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (13 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1647       1886   0    Initial    240    89        Good
gatgggttgggggagccggaggggcgggcatctccggattcccctctgacccggtggacc
aagtccttacactccttattgggcgatcaagacggtgcttacctgttccgaactttcctg
gagagggagaaatgcgtggataccttagacttctggtttgcctgcaatggattcaggcag
ATGAACCTGAAGGATACCAAAACTTTACGAGTAGCCAAAGCGATCTACAAAAGGTACATT
GAGAACAACAGCATTGTCTCCAAGCAGCTGAAGCCTGCCACCAAGACCTACATAAGAGAT
GGCATCAAGAAGCAGCAGATTGATTCCATCATGTTTGACCAGGCGCAGACCGAGATCCAG
TCGGTGATGGAGGAAAATGCCTACCAGATGTTTTTGACTTCTGATATATACCTCGAATAT

gtgaggagtgggggagaaaacacagcttacatgagtaatgggggactcgggagcctaaag
gtcgtgtgtggctatctccccaccttgaatgaagaagaggagtggacttgtgccgacttc
aagtgcaaactttcgccaaccgtggttggcttgtccagcaaaactctgagggccacggcg

Exon  2 +       3168       3202   0   Internal     35    79        Good
aatatccgaaaagagaatgagcctcttaattccggggtgtggttttatgacaggcagggg
atggggctgcacttgactgctctctgaatgatttatcttgctctctgtgtgaatttctct
gtgtgttaggggcccaggatgcggtctgatagctgcctctggatttccctttctctgtag
GATGTGGTCTCTAGTGCCCAGCAGCAGGAAGAGAG
gtgggcaccagatggttgatcttgagcctctcagggtggccaggtctgagcctagcgggc
catgattttaggggcggcagagagagttgactgttggcgaggagaggaagggcttgttct
ccaaccaccagggggcgcgcttgtggcttgggaaccagttttactcagacatctggtcta

Exon  3 +       7663       7744   2   Terminal     82    63    Marginal
cttcaaggcagtatccacgccttacttacgcacccagatggctgggcactttggcctgtt
ttaaagacttgggtgatttcacagcctgtccccacctactttatggatttcctctgacca
tttagaagtatttttttctctctaacttttgaagtctatttccccttgttcttcctttag
TGGGGATGCTGAACAGAGAGTCCCCCTTCTCAACTACGAGGCCTTTTTCACTGAATCAAC
CTTCTCTTCTCCAGAAGAATGA
actgttctttttactctcaccactcctctctgcccttggtgttggggaattccggattga
ggacacatggaccaggaggaaggcctggaagatcttaccgttctcatttaattttcacca
aaaaaatcccaggaggtcgtgagacttcttgccctctacagatatgagaacagggtcaga

Exon  4 +      10250      10386   2   Internal    137   100   Excellent
ggctcaggaggcctcccttttgtggcccctgctttctgcccaggtgagcaactggacctg
ggcagcaggttggcgttgagcagattgtgggatagtgtgctgggttgtcctggggtcacc
tgattacctgggtttctggtgagggtcagtgactgaaccacttttgtactttgcccatag
GTCCTTCAAGAGGAGCGATCCTGTTAATCCTTATCACATAGGTTCTGGCTATGTCTTTGC
ACCAGCCACCAGCGCCAACGACAGTGAGATATCCAGTGATGCGCTGACGGATGATTCCAT
GTCCATGACGGACAGCA
gtgtgtgagtatcctggccacccttccgtgggcttgcttgggagtggatgccacctgagc
acttagccagaatcgtctgtcatcctcagctggctttgcagaccgcacctgtgcatgtat
ggacatcagtttggtgggaggggagtatgacaagggtatggtgctgattaaggaggatga

Exon  5 +      10476      10579   1   Internal    104    87        Good
ggctatgtctttgcaccagccaccagcgccaacgacagtgagatatccagtgatgcgctg
acggatgattccatgtccatgacggacagcagtgtgtgagtatcctggccacccttccgt
gggcttgcttgggagtggatgccacctgagcacttagccagaatcgtctgtcatcctcag
CTGGCTTTGCAGACCGCACCTGTGCATGTATGGACATCAGTTTGGTGGGAGGGGAGTATG
ACAAGGGTATGGTGCTGATTAAGGAGGATGACATGGTCATCTGG
gtagggtaaagcttagagctttgaaagttgggaggatattgtaacagaagaaaaactaaa
ggacagtagaagattaggatgaatgaatatttatagattccttgagtttaaaaaaccttc
ttctggttgtcatcatctggttgtccctgtgggaacagttgcttggctggtccagaaacc

Exon  6 +      11752      11811   0    Initial     60    64    Marginal
gggaccagttggagggaaagttgatgaggtgagtttgggaacctactatttattttgctg
gtggcttttattgtgttacctcaaattcccttgttagtacagggagagatatcctcaagg
tgaaagtttgaattttaataaaaatagcattttggcattagtacacgtctttcatccaat
ATGGAAACAGGAAAGTACACATCTTTCATCCAATATGGAGATATGAGAAGTTTCACAGAA

gtgagttttccatattgactgaaatttcggtatccatacttgaaaaaattgtgctttgat
aattttttggtggacatatttcttagaatacattttgctctgtcattattgcatagtatt
agacagggcataatttatctctcagttatccaaataatatcaagatctgtttgtgtactt

Exon  7 +      15428      15523   0   Internal     96    83        Good
gctctccagcccacaggcttgagcagccaggaaactgatcacagacttttagagcttgaa
taaaagaagagaggcccccttttggaatgaggggctgttttggaagaagattcttggctg
gagggaattaaagccacatttccttgaaggtgcctgttaagcctttctgagcctctacag
GCTGACATCTTCCTTTTCTGCTCTGGTTACAAGTTGCCTTTCCAGCAGTTTAGTCCTTCA
CCTGCCCTGGGTAATGGAGTGTGTGTGGTGGTGGTG
gtgggggatggggggcggggtatgaggtgcttatgaaatcatttgttccttttgccttca
atattgcagttatctactcccctccccatccctacccccatcctgttttttttttttaac
cttattatatggaagaagaaaaagaggcataaaagctctaccactgactttcatctggga

Exon  8 +      18353      18455   2   Internal    103   100   Excellent
tttgaccttgggtgggtccttccctgtgggagcaccgatggtatctggagacatgtgaca
ctcctatggaagcatgtggccctgtcggcgggatctcaagatggcatatgacagtagccc
atgtgatgtgctgaaaacatcctcgtaagcctgtggattctgtcttttcctttcccttag
AGATGGAATTCCTCCTTATCGTGTGGGCAGTAAGAAACAGCTCCAGAGAGAAATGCATCG
CAGTGTGAAGGCCAATGGCCAAGTGTCTCTACCTCATTTCCCG
gtgagtacagtctggagtgaggagacagctgttttctgccatgttgagtcctaaagaaaa
gaaatgggtggtggaatggggagaggtatagggaaggtagaaaagagcagtacctaaggt
cccctagggcaaagggagagaaaagaactggacaataggcattacatggttttttgggtt

Exon  9 +      21292      21370   0    Initial     79    55    Marginal
cttatttttttaaattttcaactctctttctgtttagattctactttctattccttgagt
tggtctctcccctccccacctcagagggctgccttttttttttttttttttttttttttt
tttttttttttgatggttgacaacagtctttgaagattttctacttcaaagtaactactg
ATGGGCTGGTTGTACTACAGAAAGAACAAGCAGGGCCTCTCGGAGTGCGACCAACTGCTC
CTGCCCAAGGCAAACGCTG
gtggggaccatggctctccatgaggccatggcgctagcgcataaaagtcccgagcagccc
aggccgccttgccatccactctacacccgaacatgggtttgcggtgcacagcgcctggtg
cgggaagctccggccaagccaccgcccacctagcctgctgaacgtgcctcctccctttcc

Exon 10 +      21567      21707   0   Internal    141   100   Excellent
tccatgaggccatggcgctagcgcataaaagtcccgagcagcccaggccgccttgccatc
cactctacacccgaacatgggtttgcggtgcacagcgcctggtgcgggaagctccggcca
agccaccgcccacctagcctgctgaacgtgcctcctccctttcctttccacgtcctgtag
AGAACCCACCGCCTGCCCAAGGAGATGACCCCCGTGGAACCCGCCACCTTTGCAGCTGAG
CTGATCTCGAGGCTGGAAAAGCTGAAGCTGGAGTTGGAGAGCCGCCACAGCCTGGAGGAG
CGCCTGCAGCAGATCCGAGAG
gtaatgcggcctaggccttcttcctgcttccgtccacggcgtgagcgctcgtatgtgtat
gcgcatgtgcatggggtgcgttagggtgtgcgcatgtgcgtgggttgcatgcgcatgcgc
gtgggctgcgtgtgggtgtgtgcctgggcgtgggctgtgtgcgcatgtgcatgggttgcg

Exon 11 +      22075      22586   0   Internal    512    86        Good
gtgcatatgcgtgtggatatgtgcttgtgtaggcgggcctgtgcgtgtgcgcatgggcgt
ggctgtgggcgtgcacacgggtgtgcgtgctcctgcgtagggagccgaatgttgcaaccc
cagggcctctggcccttctgcttcctgggtcacttctccttctgacgtcttccctttcag
GATGAAGAGAGAGAGGGCTCCGAGCTCACACTCAATTCGCGGGAGGGGGCGCCCACGCAG
CACCCCCTCTCCCTACTGCCCTCCGGCAGCTACGAGGAAGACCCGCAGACGATACTGGAC
GATCACCTGTCCAGGGTCCTCAAGACCCCTGGCTGCCAGTCTCCAGGCGTAGGCCGCTAT
AGCCCCCGCTCCCGCTCCCCGGACCACCACCACCACCACCATTCGCAGTACCACTCCCTG
CTCCCGCCCGGTGGCAAGCTGCCTCCCGCGGCCGCCTCGCCGGGCGCCTGCCCCCTCCTC
GGGGGCAAAGGCTTTGTGACCAAGCAGACGACGAAGCATGTCCACCACCACTACATCCAC
CACCATGCCGTCCCCAAGACCAAGGAGGAGATCGAGGCGGAGGCCACGCAGCGGGTGCAC
TGCTTCTGCCCTGGGGGCAGCGAGTATTACTGCTACTCGAAATGCAAAAGCCACTCCAAG
GCTCCGGAAACCATGCCCAGCGAGCAGTTTGG
gtaagtgccgggcggaccgcagtgtcccgtgtggggcttgtctcccagccaggtccatgg
gcaggtgtgaggtgggagccgcattacaggcatttagtttctaagagggcggcagagtgc
acggccgggtgagggtgcggggagcaggtgcatgggtctttcgtgtcaccagccccccga

Exon 12 +      23357      23590   2   Internal    234    97   Excellent
tggactgagcagaccacaaaaatgtcatgttttggcactgacccctgttcatgttatggt
agttttttttttaactctctctctgagcagaatagacaagtttctattgaagtcacattt
tccagttcttctaacccagtttctttccttctgttttctctctgctcattccttgtttag
TGCCCAAAGCACAAAAAAGGCCTACCCCTTGGAGTCTGCCCGCTCGTCTCCAGGCGAACG
AGCCAGCCGGCACCATCTGTGGGGGGGCAACAGCGGGCACCCCCGCACCACCCCCCGTGC
CCACCTGTTCACCCAGGACCCTGCGATGCCTCCCCTGACCCCACCCAACACGCTGGCTCA
GCTGGAGGAGGCCTGTCGCAGGCTAGCTGAGGTGTCGAAGCCCCCAAAGCAGCG
gtgagtggaagtgaagggtcctaggttgaggcagggattgggtttgggtggagacctggt
ctgtggctaatggggagggcctctctttctgcctgggtctcaaaccctcccatgagaaga
agaattacttatggatgagtaagctgctgctttccagcttctagaaattgttcccttcag

Exon 13 +      25831      26002   2   Terminal    172    99   Excellent
ccccagagctgcctgactctgggatgtggggctctgccccagcccccactttgggtttac
aattgcagccctagtgtttggataccctgtcacttatgcacatgtgcgcacgtgtgtgtt
tgctttagatgtgtgtctgctttaaaatgctaaacttgttccattccatcttattttcag
TCACAAAGAGCCAAAGAAACTGGCAGGTGTCCACGCGCTCCAGGCCAGTGAGTTGGTTGT
CACTTACTTTTTCTGTGGGGAAGAAATTCCATACCGGAGGATGCTGAAGGCTCAGAGCTT
GACCCTGGGCCACTTTAAAGAGCAGCTCAGCAAAAAGGGAAATTATAGGTAA
gagtcctgtggcttttttctgctctcagtttgtttgctcagaaccaagagccagagcctg
gagcagctcccctggctgagcagacctaggtggggcagggtgggagggggctcagcaggc
gctgggggaggctcccttctcatttcttctctcccctcaccgctagcagcaataacgaag

--------------------------------------------------------------------------------