--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (17048 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (15 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1234       1368   0    Initial    135    87        Good
gctcgcaggtttgggctagtctggggcggggacttgggagcgcctaaaacttgcgaggag
ggcggggccgcagaccggtcctttaaaggttggaagtggccccgaggcgccggcagccct
gggcggtcccgggaatcgcacaggacccggctcccctcgcctaagctgctggggggcgcc
ATGGGCCGCTACCGCATCCGCGTGGCCACCGGGGCCTGGCTCTTCTCCGGGTCGTACAAC
CGCGTGCAGCTTTGGCTGGTCGGGACGCGCGGGGAGGCGGAGCTGGAGCTGCAGCTGCGG
CCCGCGCGGGGCGAG
gtcagcgcggggagcgaggggagctagggcagcggggaccccgggcccaggcccgggccg
agctgggctcgcggcgggagggcgggaggctgggggcgaggtgacagcgcgacctcgcgg
actgggacttccacgaagctgggacgaggtgggcaagattagggacagggtccgcagctg

Exon  2 +       1942       2262   0   Terminal    321    95   Excellent
tcctccacccgactccgggcgtctgagacccaaagagcaggttgtgcgggggcgggaacg
aggcgatgctgtctttggaggccctgagaaactgaggttgcacaggagcgcggctctgtc
ctcgaaacggcctcagtcgggtccctcctactaagtctggcctgggtccggcctgcacag
GAGGAGGAGTTTGATCATGACGTTGCAGAGGACTTGGGGCTCCTGCAGTTCGTGAGGCTG
CGCAAGCACCACTGGCTGGTGGACGACGCGTGGTTCTGCGACCGCATCACGGTGCAGGGC
CCTGGAGCCTGCGCGGAGGTGGCCTTCCCGTGCTACCGCTGGGTGCAGGGCGAGGACATC
CTGAGCCTGCCCGAGGGCACCGGTGAGCAGGCGGCGTCGGGGAAGGAGGCACAAGGTCTC
GGGAACTGCTGCGGGGCTAGGAGGGCAGAGTTAAGGACGGTCGGAGCAGACTTAGAGGAT
GTATGGGCCCAGGGCAGGTGA
aatgtagggatcccagggtgctggacagaaaacgggaaggagttatgaattcccaaagtt
ttacacaggctaagagaggctgcgtgtgaggctggaggcagggagtaagtgatctggaga
tcccatcttccaagaaggcaaagacagaaagtgggagttgcagcgatccaggaaaacaga

Exon  3 +       3558       3706   0    Initial    149    51    Marginal
gtggcaaacaggaggtttttatctacaggcaaaggatgagggctgaaataagagaaagca
ggagtgcaaagttggcaaagatgggataaacgtgtctggtggataatcaaatgaggcaaa
gccagagataaaagcaacagtgcatggctgaaaacatggaatacggctaaccacagggag
ATGAGGACAAGAGGCGGGCATAGGACCAGACAGAGCCGTGAGGCCAATTGTCTTGATGTC
TCCCCAGCCCGCCTGCCAGGAGACAATGCTTTGGACATGTTCCAGAAGCATCGAGAGAAG
GAACTGAAAGACAGACAGCAGATCTACTG
gtgaccacccaccccttaaactaaccccgccaccactgtcccaccccttccctgcccctg
cccctgcccctggccccatcactgaccatgacatccttcctgaagctttgtccccaactc
ctagctgggccacctggaaggaagggttacccctgaccatcgctgcagaccgtaaggatg

Exon  4 +       3831       3953   2   Internal    123    61    Marginal
gacatgttccagaagcatcgagagaaggaactgaaagacagacagcagatctactggtga
ccacccaccccttaaactaaccccgccaccactgtcccaccccttccctgcccctgcccc
tgcccctggccccatcactgaccatgacatccttcctgaagctttgtccccaactcctag
CTGGGCCACCTGGAAGGAAGGGTTACCCCTGACCATCGCTGCAGACCGTAAGGATGATCT
ACCTCCAAATATGAGATTCCATGAGGAGAAGAGGCTGGACTTTGAATGGACACTGAAGGC
AGG
gtgagaaaaaggctagacctcggagtgaaataagggctgggagggccaagaatgatgata
gacggtgagggactgagggatcagctgatgagttaagcctcaatacctgtcctagggctc
tggagatggccctcaaacgtgtttacaccctcctgagctcctggaactgcctagaagact

Exon  5 +       4069       4172   2   Internal    104    96   Excellent
ctacctccaaatatgagattccatgaggagaagaggctggactttgaatggacactgaag
gcagggtgagaaaaaggctagacctcggagtgaaataagggctgggagggccaagaatga
tgatagacggtgagggactgagggatcagctgatgagttaagcctcaatacctgtcctag
GGCTCTGGAGATGGCCCTCAAACGTGTTTACACCCTCCTGAGCTCCTGGAACTGCCTAGA
AGACTTTGATCAGATCTTCTGGGGCCAGAAGAGTGCCCTGGCTG
gtcagtggttccccgaggtctccataatcccttaatggcccctctggatgactcatcaca
ctccacagtcccccgtaactctttgcaagaagagaccttatcatatctggtcaactcaga
gaggccttgagaatgaaaacgcagaagctgggttcagggagggttatatacctgaacccc

Exon  6 +       4383       4582   1   Internal    200    63    Marginal
cttaatggcccctctggatgactcatcacactccacagtcccccgtaactctttgcaaga
agagaccttatcatatctggtcaactcagagaggccttgagaatgaaaacgcagaagctg
ggttcagggagggttatatacctgaacccctggggtagattttggagaagggatatgcag
GCTGTGGTACATATATCCTCCTTTCACCGCCCACCAAAGAGAAGGTTCGCCAGTGCTGGC
AGGATGATGAGTTGTTCAGCTACCAGTTCCTCAATGGTGCCAACCCCATGCTGTTGAGAC
GCTCGACCTCTCTGCCCTCCAGGCTAGTGCTGCCCTCGGGGATGGAAGAGCTTCAGGCTC
AACTGGAGAAAGAACTTCAG
gtacctctccttcccctgcctggcactgttctctccttagtagtgtggtgagaacggaca
gagagaatccaaactgagtcagaggaaggctgcagtactgcattgccccttggtgcagtc
ctgtgctggaaaaatacagaaataaaatatgtaggggaagaaactatgaggagctcccag

Exon  7 +       5452       5632   0   Internal    181   100   Excellent
agactgtttcttcactttaagatgagaggaactggaccaggggctctagttctcccaaca
gggctccggtactgatgcaggagaatggcaagaagctagactaaatctcttgccctttgc
cccggccccctgggggtagactttgaactctaaaaatggatacatccctcctgtccccag
AATGGTTCCCTGTTTGAAGCTGACTTCATCCTTCTGGATGGAATTCCAGCCAACGTGATC
CGAGGAGAGAAGCAATACCTGGCTGCCCCCCTCGTTATGCTGAAGATGGAGCCCAATGGG
AAGCTGCAGCCCATGGTCATCCAGGTAAGGGCCCCAGACCTCTCCCACAACGTTGCACTC
T
gttcacctcaacctctgctcccagggacccaacccccagctcttggctcccaaaccccat
cctcactcagtgagacttgtcttcatgtcactatttgcctgtaccctcgtctcccctgcc
tcatccaactagaattactttttcaagagtcaaaatggcctcctggagttctcatcctgt

Exon  8 +       6770       6896   1   Internal    127    77        Good
acagtcctcctgctagactataacctcctagaaggcaataatcttacttagtcatctctg
tttccccaagaatgctgactataatgtcatatacggaatgggagttcaataatttctctt
tctcccagattcagcctcccaaccccagctctccaaccccaacactgttcctgccctcag
ACCCCCCACTTGCCTGGCTCCTGGCAAAGTCCTGGGTCCGAAATTCAGATTTCCAACTGC
ACGAGATCCAGTATCACTTGCTGAACACTCACCTGGTGGCTGAGGTCATCGCTGTCGCCA
CCATGCG
gtgcctcccaggactgcaccccatcttcaaggtacttattaatctattaaatcacatatc
cctcagaccccagagagaggaacagccccatatcaaaagatattgcagcagcaaaaactc
tttgtagcaatttgtgagtgaagaggagactgtctcaatatcttgagatgttgattttaa

Exon  9 +       8729       9075   1   Terminal    347    68    Marginal
ttttttttttcagagacaagttctcactctgtcacccaggctggagtccagtggcgtaat
cataactcactgcagcttcaaactcctgggctgaagcgatcctctaacctcagccttcag
agtagctgggactacaggtgtgcaccaccatgcctggctaattttttttattttttgtag
AGACAGGGTTTCACTATGTGGCCCAAGCTAGTCTCAAATTCCTGGGCTCAAGCGATCCTC
CTGCCTCAGTCTCCCAAGTAACCTGGATTGCAGGCACATGCCGCCACACCCAGCTAGTTC
TTGCAATTATTATTATTAAGGACTGTTTATCCTTAGGCATCCTTTCTCCTCATGTGGACT
TTGGCCTTTCCGTGACATTTGGCATCTTTCATGAATCTTCTGAAAAGCTTCAGGTTAATG
TGAGCTGCTTTGGTATCTTAACACCAAAGGTGTCATTGGGGTCATTGCCAGTGTCCAGCA
TCAACAATTCAGACAAGCACCAAAACTGCTTGAAACCTGCATGTTAA
ctatgtggaaaggaagacaaacagtctaagataaaaagaaacgcatgtaaggaccatgcc
ttttttaatagctaaggaaaatattttaatatttttaatttaataaattttaatttatta
aaattaaaattttaatttaatattaaattaaaattttaattttaattttaaataaataat

Exon 10 +      10331      10459   0    Initial    129    96   Excellent
aatgaggagtaaagtgtaggttaaaatcctggtcagtctggctccagggcccaactcaca
gggaagttggagagcacaagagtgagtgatcagaacagcaggagatcagcctgtaaagga
aagcatcaagaggagaaggcgccatgctgggtgccaggccctaccaggaaggacccaagc
ATGGCCTCCACCAGTCACGCCCTCCAATCTCCTCCTCTCCAGTTCCTGATCCCCCATATC
CGCTACACCATGGAAATCAACACCCGGGCCCGGACCCAACTCATCTCAGATGGAGGAATT
TTTGATAAG
gtgaggagggtacggggcatgggactgcctcatccatctctccatgatctgccactttca
ggatccaagatcaactatgtgtgaatgtcctcactcttaacctatgaacctgtccctttt
atacccatgtcttttttttttttttttttttttttgagacagagtctagctctgtcgccc

Exon 11 +      10974      11143   0   Internal    170    86        Good
actgtgttggccagactggtctcgaactcctgacctcatgatccacccacctcagcctcc
caaagtgctgtatacccatgtcttaatatctgaaaatcccacatttgccccactttatgg
aagatgtgttggttctccagccctgtttccccctctaagacctgtgatctcctgtcccag
GCAGTGAGCACAGGTGGAGGGGGCCATGTACAGTTGCTCCGTCGGGCGGCAGCTCAGCTG
ACCTACTGCTCCCTCTGTCCTCCTGACGACCTGGCTGACCGGGGCCTGCTGGGACTCCCA
GGTGCTCTCTATGCCCATGATGCTTTACGGCTCTGGGAGATCATTGCCAG
gtgagtaaggaggagctgagaaatggtggggccggggggggggggggctctggcctgagg
ccagcatggggcaaaagcaagaaggtccagaaaggagaagcagagaactcaatcctgggg
agagatgaggaaaagtgaggacacagtgggtggctctgaaaatgaggagactgggatgag

Exon 12 +      11602      11723   2   Internal    122   100   Excellent
tcctagaactaaggacccacatcttccatgagatgctagtgtgtttagagggctgaggat
gtcccaaaggcgaggtgtcttcccagatactgtggaagcattgggcagatgccacagaaa
gaggaatagaggtcagaggcgggggctttctgccctcaagtgccttttccccctgggcag
GTATGTGGAGGGGATCGTCCACCTCTTCTACCAAAGGGATGACATAGTGAAGGGGGACCC
TGAGCTGCAGGCCTGGTGTCGGGAGATCACGGAGGTGGGGCTGTGCCAGGCCCAGGACCG
AG
gtaagatccattctagagacagaagaagctcctgggagactctgccagggcgccttccca
gccctgcccttctggggacaggaccccagcctctcatcacgcctcccttcctccctccac
acgggaaagcatgtgtatcccattcccacctcctccgactcaggacaattctagagaccc

Exon 13 +      14863      14963   1   Internal    101   100   Excellent
ctggcctatggtaactaagtgtaagtgactgagccaggacttaaacgcatgtctgatgca
aatacgtctaaataaaataaacaaattcatcaattctaaaatatgggcatcccaaaacaa
cagcctttgttcctctcctcttatgctgtagcttctaactgctattcctttcctgcccag
GTTTCCCTGTCTCCTTCCAGTCCCAGAGTCAACTCTGCCATTTCCTCACCATGTGCGTCT
TCACGTGCACTGCCCAGCATGCCGCCATCAACCAGGGCCAG
gtatggacagctgaaagcccaggtccctgaaggcaaggtgacctgagggagagatgggag
ttcaaaccctaagtaccagggttctagggttacagtttcttcctccagctggactggtat
gcctgggtccctaatgctccatgcacaatgcggatgcccccacccaccaccaaggaagat

Exon 14 +      15072      15242   0   Internal    171    79        Good
caactctgccatttcctcaccatgtgcgtcttcacgtgcactgcccagcatgccgccatc
aaccagggccaggtatggacagctgaaagcccaggtccctgaaggcaaggtgacctgagg
gagagatgggagttcaaaccctaagtaccagggttctagggttacagtttcttcctccag
CTGGACTGGTATGCCTGGGTCCCTAATGCTCCATGCACAATGCGGATGCCCCCACCCACC
ACCAAGGAAGATGTGACGATGGCCACAGTGATGGGGTCACTACCTGATGTCCGGCAGGCC
TGTCTTCAAATGGCCATCTCATGGCATCTGAGTCGCCGCCAGCCAGACATG
gtgagaggggactctcgggagagggaaatgacagttggaaaggaaacatcagagtgaggg
gctgggctctaggtgcgtttgtctttagaaactgactgatcctttgttctgtctcaggtg
cctctggggcaccacaaagaaaaatatttctcaggccccaagcccaaagctgtgctaaac

Exon 15 +      15360      15539   0   Terminal    180    95   Excellent
gtccggcaggcctgtcttcaaatggccatctcatggcatctgagtcgccgccagccagac
atggtgagaggggactctcgggagagggaaatgacagttggaaaggaaacatcagagtga
ggggctgggctctaggtgcgtttgtctttagaaactgactgatcctttgttctgtctcag
GTGCCTCTGGGGCACCACAAAGAAAAATATTTCTCAGGCCCCAAGCCCAAAGCTGTGCTA
AACCAATTCCGAACAGATTTGGAAAAGCTGGAAAAGGAGATTACAGCCCGGAATGAGCAA
CTTGACTGGCCCTATGAATATCTGAAGCCCAGCTGCATAGAGAACAGTGTCACCATCTGA

gccctagagtgactctacctgcaagatttcacatcagctttaggactgacatttctatct
tgaatttcatgctttcctaaagtctctgctgctaaggctctatttcctcccccagttaaa
ccccctacattagtatcccactagcccaggggagcagtaaactttctctgcaaagactag

--------------------------------------------------------------------------------