Gene XPO6 Variant 1
DNA : 113.99 KbNT_010393
mRNA : 4482 bp XM_055195
CDS : 3378 bp XP_055195
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  548 bp
agccgtcaggtgcagccccgccctccgccctccgcccgctccccccgctcgccccgctcg
attccggattggtccggttccagcgccgcagcccggcggccgcgctgtggggccgcccgg
cgctcgccacttccggcgcgttggggctgttggtcgggggcggccgcgcggtactagcgg
GCGGCTCCAGGGCGGGCGCGCGCAAGGATGCTCTAGGGGGCGGCGGCAGTGGCCGTGTGG
GTTGAGGCTGCGAGGACAGCGCGGGCCCCCGGGCCTCTCCCCTGAGCCGGCCGCCTGGGC
CGCGCGGTCGAGGCCTGTCAGCCTCCGCCCGTTCAGCCTCGGGGCCGGGGCCGCCGCCAC
CTCTGCCCGCGGAGGCCGGGGAGCCCCTGCCTGGGCCCGCAGCCTCCCCCGCGGGGGTCG
GGCCCGGGCGGGGGTCCCGAGCAGCTGCCCTCCTCGCCGGCATCCGAGCCTCATTTCCTG
CTTTTTCAGTTTCCTTGGGGAGGGGCGGGTGGGTCTGGATGAATTGTCTCGGGGTCCCCC
GATGAGGCGACCCGGGCGGCCCTGCCCTTTTTAGAGGGTCCCCTCGGGGCCCGGTGGGGA
AGGGGTTGTCTTTGCATGGGTGGGGGACTTCCCGAGTCTGCCGGGACCATGACCTGAACT
GTGCGAGCGGGACGTGTCCGAAGCCCAAGAACCAGCTCATCTGAGCCGCCCCCTCCCCGG
CCAGCATG
gtaagtggaattggagcccccttccctcctggggtgccctaccggaagggtgggaatggg
ccccggggctgctgagccatcgctgctctccccatggcggggagaggcgcgtgcggagcc
tggccggtgacacatgcgtgcagagtgtgcagccccggccctgcgctcccatccccccag
EXON 2  91 bp
ttgagccagctgggaaattcccttcagttttttctggcatataccatgcatttgaagaat
gttgaaccaagattttgaggaagtaaattgctcttgctgttgaatgtgacctagaaggaa
ctgaggaacagtggaactgaagatgcagcttattgattttttttcaaattcctttgttag
GCATCTGAAGAAGCCTCTCTCAGGGCATTGGAAAGTCTGATGACAGAATTTTTTCACGAT
TGTACAACCAATGAAAGAAAACGTGAGATAG
gtaagtggagcattgacttgtaaagaggaatttataatgaggaggccctggtagggagga
aggagttgttcgtagccgtgactggtcaagtctgcgtgctttccacttgaattcttgctc
ttttcgctctggttctgttggctggtggctggggaaacccctccacttgaccaaaggaaa
EXON 3  113 bp
tcacctcagacgcagaaaaatattgtatgatttattctttctatcttaaagaatccgctg
gttttgacatcatttacattatatgcagagagacatgtttaaataataataagatagccc
agtcttgtctaatttcatgtattttcatagctttcttttgttgccatttaacttttccag
AGGAGCTTCTTAATAACTTTGCCCAGCAAATAGGAGCCTGGAGATTCTGCCTGTACTTTC
TCTCCAGCACTAGGAATGACTATGTAATGATGTACAGTTTAACAGTTTTTGAG
gtaagttgtcagtaattttatactcttctgaaaaggattttgtagttctattgccatatc
attagcactagactagagctgtaatgtgctgggagagggtagctcagctctgggatgtcg
tcccacatactgtctttatgtagttgtctggtgtttggggcatcttccatcttccacact
EXON 4  198 bp
aatgggactgttgtgtcctaagatttgaatacttttattattcttattgccatattgccc
caaacctttatttaaagagggattcttgtttattgaagtgataatagctacctgtgggat
gaaaagcagttatttttgtgtataggttgttaacttaaaagatgtatatttgtttttcag
AATCTGATCAATAAAATGTGGCTTGGGGTCCCATCTCAGGATAAGATGGAAATCCGTAGC
TGTCTGCCCAAACTCCTTTTGGCTCACCATAAAACCTTACCTTACTTTATCCGGAACAAG
CTCTGCAAAGTTATTGTTGATATTGGACGTCAGGATTGGCCCATGTTCTACCACGACTTT
TTTACTAACATTTTACAG
gtaaggatatgcctaaggaaactttatcttgtgaatagtttgtttgttgaagtgattatt
tccttgtcctgaagaggacttttaagattagcagtttggaactgcagtagtgaggttatt
gtaggactgattatcgcattcactttatatttataagacatattgtatctttgtgaggtg
EXON 5  160 bp
aagtgctgggattacaggcgtgagccattggagctggcctctaagtgatgtttctgaagt
gttgatttatgttcatgtaagattaaacacacacagatgcttcacagctttaatgctact
gagtcctctttgtactttattagtccaacactctgctcagaacatgctttttcctggcag
TTGATCCAGTCCCCTGTGACAACCCCCCTTGGGCTGATCATGTTGAAGACAACTTCAGAA
GAGCTGGCTTGTCCCCGTGAGGACCTCAGTGTGGCTCGGAAGGAGGAGTTGCGGAAGCTG
CTACTGGACCAGGTGCAGACAGTGCTTGGGCTACTGACAG
gtgagcagtatggtagtgcccagagatagaggcctgcccgcaggcacccagagttcaggc
cttggcactcagcagctttgagcagttgtttgcgctgtttctgagatagcatgaaaatgg
gaagctgcgttcccaacacctatagcccagggtctagcacacagtaggactacaaaatag
EXON 6  78 bp
agagccagaagatagctgtgaagtcgagaggcacagccgctagctggaggaggacatggt
caagaaagggatgttcaagtactcatgtttgatcagaggtatcaagaaactttctctaaa
tatgatttttatatgctggacattatttctcttataactctgtttctcctttcttggtag
GTATCTTGGAGACTGTCTGGGACAAACACAGTGTTACTGCTGCCACTCCACCACCATCCC
CGACCTCAGGAGAAAGTG
gtatggtctgcctgccagccaaggcattcttctttttaaatgtattgggggccaggtgtg
gtgatttgcaactgtagtcctcagtactgaggaggctgaggtgggaggatcactagaggc
caagagtttgagaccagcctgggcaacatagtgagactctatctctgtttttaaaaatta
EXON 7  454 bp
aaatttcctaattagtgtttaactttgagcatatagattttatttttttatttcataggt
aactaaactgatacatatatgtatacatatatatatatatttttttttgaaggagaatta
cttaaagtcatttgtaagagatttgatgctggatagcttaaaagcctttcttattttcag
GTGACTTACTGAGTAACCTGTTGCAGAGTCCCAGTTCAGCCAAACTGTTGAATCAGCCAA
TTCCCATCCTTGATGTGGAGAGTGAGTATATCTGTTCCCTGGCTTTGGAGTGCCTGGCCC
ATCTCTTCAGTTGGATTCCTCTGTCTGCCAGCATCACCCCATCCCTCCTTACCACCATCT
TCCACTTTGCACGATTTGGCTGTGACATCCGGGCCAGAAAGATGGCGTCAGTTAACGGCA
GCAGCCAGAACTGTGTCTCGGGTCAGGAGCGCGGCCGGCTGGGGGTCCTGGCCATGTCCT
GCATCAATGAACTCATGTCCAAGAACTGTGTGCCTATGGAATTTGAGGAGTATTTACTGC
GTATGTTCCAGCAGACTTTCTACCTCCTGCAGAAAATCACCAAGGATAACAATGCCCACA
CAGTGAAGAGCAGGCTAGAAGAGCTCGATGAGAG
gtaatgaaaccaagtgtggagctggtgtgccccaagaaagggccctgactgtttaccatg
ctgtgctgcatggcatctgtaatcctctttgatttcagaatatggggctcctggtgagga
acagaaaggtaggtgtgtgccagtaagtctgagattagctggaagggcttgggtggttaa
EXON 8  127 bp
ggtggttaatggaatgaagggttgcctgtcctgtaggtaattgttgcaggcctttatatt
tttaaaagaaaatatattacaaatttgtatagttctgtactgaaagaactttggattgaa
tttaagttctaaggaggtggctgggtttcttattgtcaccttttgtcttgtctcatttag
CTATATCGAGAAGTTTACTGACTTTCTTCGGCTCTTTGTGAGTGTTCACCTAAGAAGAAT
CGAGTCTTACTCCCAGTTCCCTGTGGTGGAGTTTTTGACACTTTTGTTCAAGTACACATT
TCATCAG
gtaaagcaccaaagtcatccttcccttccagagaaaaggtttattaccttgttactttga
gaagaaagaactttttctttcaactttattttccaaacattaatataatgcttattatgt
gaagagtcacaggtttaatcttcctaacatccctgtgaagtaggttctattaccattgtc
EXON 9  110 bp
ggttcaggagggcccaatggtatagaccgactaaaagccaccagttttggttaccaggaa
actggggaatctaggcttatgatttcatcattctgctggaattaaacactggcatgtgtg
tgtttctaaggaatagtagcattaaataatttcattgtctggattttttttgtaccatag
CCTACTCATGAAGGTTACTTCTCTTGTTTGGATATCTGGACGCTGTTTTTGGACTATCTG
ACAAGTAAAATTAAAAGTCGTCTTGGAGACAAGGAAGCAGTTCTCAACAG
gtaaactcctcaaacactgaaaactagatatggtcattttgccagttattctagtggcct
aagggacagccatgcatttggaccttttcagtgaagctgagtcatgtaagctgtttaggc
aataatgccattgagcatttccttttttttctcctttaagtattttgttaagacttttta
EXON 10  109 bp
ctctgcttctcttccatgggcgcacacacgtaccaacccataaactcagcctcaggaatt
tcgatgctctttttccatggtgatcaacatagacaccatttcttttatagtgcaggaggc
attttccaaattctaagctgaaagcctcctttcaatgttgaatttctccctgccacatag
GTACGAAGATGCCCTGGTGCTCCTGCTCACAGAGGTGTTGAATCGAATCCAGTTCAGATA
CAACCAAGCCCAGCTGGAGGAGTTGGATGATGAGACTCTGGATGACGAT
gtaagcggcatgccctgattgattttttgtcgctgtcatgttgtgacatcaatcagaatg
gggacctggaacccagagccctctgctccgaagactgttctgaaaccagagtagtcttct
ggtttgagtcgtacatttgaaatttttaatctcctgctggtcccttttggcttattaacc
EXON 11  93 bp
tttttgtgaaattaattcattgtttttaaaaaattctagcttggcctttttatagtacca
gataacctggttccatcattttccatttcttcaaaattttatgtctgagagtggtcttga
ggttggcaaggaagatgagaggattctgggagagctgattctcctgtgcttcccctacag
CAGCAGACGGAGTGGCAGCGGTACTTACGGCAGAGCTTGGAGGTGGTGGCCAAAGTGATG
GAGCTCCTGCCCACGCACGCCTTCTCCACACTG
gtaatgtgctgtccgggggagtggagagtgtagcgatttctctgtacacagagcatggct
ggttgactcccctggatctctctctctctcccctctttcccctctatgtaatttttaaaa
acagaataattaccataagtgatgctcaaactgaacaaatattaacatttccacaaaata
EXON 12  70 bp
tagttggggggcactgaaggggggtcatagctttttagctgcatttaaaggttcccagag
aaaaggttttgatcctgttcctcacaccatagttacgtgttaatgttgtaatgttaaaat
gctattaaaacttgcatttatggcttaaaatttttgttgtttttgtttctttgttttcag
TTCCCTGTTCTTCAGGACAATTTAGAAGTTTATTTGGGATTACAACAGTTTATAGTCACT
TCAGGGTCAG
gtaaactggtttttattttctaatttaaccaaacattcaaaaaaccatcggactgatatt
tcattactgctgccgttgctgtcggaacatgatttcttcactgcagcctccccactggca
tctctccccacttcgaaacagggaacgtttttaaaggcttatgataaaaagctgtggggg
EXON 13  160 bp
taggtggataccgggcccagtttccctgctcagtactgggaagcagcccgtgggttgctt
tgtttcgcgaattggttttgctgctggttttgctgtgtgtggcttgctggaccagctgtt
atctgtagtatctaaagcgtggtcttcctgtgaaaaactgtctggcgtgttgtgttccag
GACACAGGTTGAACATCACGGCGGAGAACGACTGCCGGCGGCTGCACTGCTCCCTGAGAG
ACTTGAGCTCCCTGCTGCAGGCCGTGGGCCGCCTGGCCGAGTACTTTATCGGGGATGTGT
TTGCTGCACGGTTCAATGATGCCCTCACAGTCGTGGAAAG
gtaggctggcagttaccttatggagctgttccttcttcagagttcagctttaccttcttg
tgtgaggggcagcatattgccaaatagcttctgctctggccccgggtaaatctaggctct
gccacatacaagctgatagggaacaaattacttaacctctctgaacttcaggtccctcat
EXON 14  93 bp
ataaatctttatgcatatctcagattatttccttggcataaaattgaaagtctggtcttg
attcttttttgtatatgaaaaagtctgcccttacgctctttgctggtaccagccttgtct
gttttgtctgtcttagttcataagctgaatgttcttgtttacctgcctctttgccaacag
GTTGGTCAAAGTCACTCTGTACGGATCTCAGATAAAATTGTACAACATTGAAACTGCTGT
GCCATCAGTATTGAAACCTGACCTCATTGATGT
gtaagtctagagtttgatgtttgtgcatttttaggaaagaccttgcccccaatctccaaa
taatttgattgagaaaaaggaacagtagtggctgccatgaatcagggaaaaactcttaaa
ctgcaaacctagaaagagagagagatttttttgactatatgtctggggcagaggcggttg
EXON 15  145 bp
agatgatgaatatcttagtttttaggttctacgtgaaccggtaaatgatttctatgctgt
tgcccatgtcttagaacagcaaatgcagtggatgcaattcttacctcctatgaaaatgag
ttgaacgctaatatattttcaccttaacctttaaaatcacatcttcttttctttctgcag
GCATGCTCAGTCCCTGGCTGCGCTGCAGGCTTACTCTCACTGGTTAGCACAGTATTGCAG
TGAAGTTCACCGGCAGAACACGCAGCAGTTCGTGACACTCATCTCTACTACCATGGATGC
AATCACACCTCTAATCAGCACCAAG
gtctcgaaacagcaaagcctacaccttttatctaactctctgtctctccttctgttccta
tacccatttactagaaaatctaaatatgacacagagttagacccataaatctttctgctg
ttatacatctgttttatttcatgttcctttttagttgtagcctacatgcattcagataca
EXON 16  147 bp
catgacagagaagatgggcttctcttgtagtcatcataggaaaaattcttgagctagata
gggcctaggtggtgtaatttggaaaccaagaatgacacatagcttgtggctgcctcagca
aagttcgaatcccagtcttacagggatgtggtgagctgacgtgccctcttccctctgcag
GTCCAAGACAAGCTGCTGCTATCTGCGTGCCACTTACTGGTCTCACTGGCCACCACCGTG
CGGCCCGTCTTTCTGATCAGCATCCCTGCAGTGCAGAAAGTATTCAACAGAATCACTGAT
GCCTCTGCCCTGCGACTTGTCGATAAG
gtgaggccccagagctcccccggggtccccagggctgtgtgactgagacccaaggaagct
gaggaagaagagtctggcctttgattttgtactcagagcttacaggctgtaccagcatag
acagatttcttattgtgtggcactgacacagactcagtgattctcatcgtgcccattcta
EXON 17  190 bp
tcatcttcctccctaagctgccttccagttggaccaaaggccttgcccaggttgcaagaa
acgagcctgggggctagggttccaggtgtgcagccagcgggtgctgaaggctgtgttggg
catgccgcaccacggtctttggctctgacctctgatggatgcctttggggtctcttgtag
GCCCAGGTGTTGGTGTGCCGAGCCCTCTCTAACATCTTGCTGCTTCCGTGGCCAAACCTT
CCAGAGAATGAGCAGCAGTGGCCCGTGCGCTCCATCAACCACGCCAGCCTCATCTCTGCA
CTCTCCCGGGACTATCGCAACCTGAAGCCCAGTGCTGTTGCCCCACAGAGAAAGATGCCA
CTGGATGACA
gtaagtgacccctaggctaggacagctggggaaggaggtaggcaggcattgttctttgtg
gcagatgagatttgccccggaggctcctgaggtaaattttttttgttcatagtcccacag
aggctgagcaggaagtcatacttgggggtgggatcctgctacctttggaattcagttaag
EXON 18  156 bp
caaaaactaaaacataaagagaggagaatttatattgtaatcaagagactgttcctttag
tgagactcgtgtgatcatcttcttggtacctttgcaagtttcctccctctcccttgtgtc
tcctcttaccatgctttctccccagacagcttataacctgcaactcatcttgatttgcag
CCAAACTGATTATCCACCAGACACTCAGCGTCTTAGAAGATATTGTGGAGAATATCTCGG
GGGAGTCCACCAAGTCTCGACAGATTTGCTACCAGTCGCTGCAGGAATCTGTTCAGGTCT
CCCTGGCCCTCTTTCCAGCTTTTATCCATCAGTCAG
gtaggagctggcccagaggccccactggtgggtggtgctaacaagggccagaatacccac
ttagatctgtagaacacactgagtcggtgcagtacaggccttgacttgttccgtgcaacg
aaacccggtactgaggggaaagggcagtgatgtttatttgtggagtctagggccaaggcc
EXON 19  115 bp
gcatgtccctaatcgttttccactttccatcattggccctgatggtgttggggaaatgtt
tccagcaggaagctgtagagaaagctgatagtgcagatttcaggagtaggttgatgaagc
ccagggttctggttctcactgtgtgcaagcctctgacgatatctctgcccctttcctcag
ATGTGACTGATGAGATGCTGAGCTTCTTCCTCACTCTGTTTCGAGGCCTTAGAGTACAGA
TGGGTGTGCCTTTCACTGAGCAAATCATACAGACTTTCCTCAACATGTTTACCAG
gtaagcacagacccaccatctatagttttcagattcaagggagaagtggtgggtctggcg
acaaagtgtggctttttgctcctgttctgcacttgccacagcatgggttttcatgctggc
ccccagagaaacatgtggttgctcactgtgtggctttctcctctgtagagagcagttagc
EXON 20  172 bp
catgtttaccaggtaagcacagacccaccatctatagttttcagattcaagggagaagtg
gtgggtctggcgacaaagtgtggctttttgctcctgttctgcacttgccacagcatgggt
tttcatgctggcccccagagaaacatgtggttgctcactgtgtggctttctcctctgtag
AGAGCAGTTAGCCGAGAGCATCCTCCACGAGGGCAGCACAGGCTGCCGGGTGGTGGAGAA
GTTTCTGAAGATCCTGCAGGTGGTGGTCCAGGAGCCAGGCCAGGTGTTCAAGCCCTTCCT
CCCCAGCATCATCGCCCTGTGCATGGAGCAAGTGTATCCCATCATTGCCGAG
gtaggggctcagacggtcccctgtgcagcaccccccatctccagattgggaagggaatga
gatttcacagaaaatgtattgtgttttaaagttcatttgttagtttaatatgcttgtaaa
gtagtttctcccaaggaagaaggcctttagtggtgtggtacagtgtttttatattgattg
EXON 21  162 bp
caggcagtgacaggactccaggggctggatgtcttttgcgcaggtagtgacaggcatgtg
gatggagtgttgacactcggcttgctgtcacgaggcgtctcctaggcatctttgctgccc
tgggcccaggccggagcagctccgcaagctgcaggtctgagcgtctgtgtgtctttgcag
CGTCCCTCCCCTGATGTGAAGGCCGAGCTGTTTGAGCTCCTTTTCCGGACGCTCCATCAC
AACTGGAGGTACTTCTTCAAGTCCACCGTGCTGGCCAGTGTCCAGAGGGGGATCGCTGAG
GAGCAGATGGAGAATGAGCCCCAGTTCAGTGCCATCATGCAG
gtaacgtgggggcggggttgctgccaggtgacttcctctaacctgaccactgcagcgagt
cctgtcttcgaagccccacagtctcgggtctgaagctcagttctgcctgttagtattgat
gaagttaattaatttcttggagcctcagtttcttcatctgcaaagtggagctaatgttgc
EXON 22  99 bp
cccggtggggaaaacatgaactctgagacttaggaggagcgtcgtagaggtctgagctgg
tgggccagaagcatcaagacaatgggtaccctggccctggcacttgttcttctgacatgg
ggtagatgctccagaagtgcttggtcttgcagtttataaaatggtggtctcatttcctag
GCTTTCGGACAGTCCTTTCTCCAGCCCGACATCCACCTTTTTAAACAAAATCTCTTCTAC
TTGGAGACTCTCAACACCAAGCAGAAGCTGTACCACAAG
gtaagtgccccagctcttggaaatattcttccatcaggggcattgtggcctgtgtcccac
cctcaggttactcactggagagtgtgacagaaagtggatgggacccgggacaggcccctg
ggggctggctgctgctcacctggtctctctgcctgcagaagatcttccggactgccatgc
EXON 23  231 bp
caagcagaagctgtaccacaaggtaagtgccccagctcttggaaatattcttccatcagg
ggcattgtggcctgtgtcccaccctcaggttactcactggagagtgtgacagaaagtgga
tgggacccgggacaggcccctgggggctggctgctgctcacctggtctctctgcctgcag
AAGATCTTCCGGACTGCCATGCTGTTCCAGTTTGTGAACGTGCTGCTCCAGGTCCTGGTC
CACAAGTCCCATGATCTTCTGCAGGAGGAGATTGGCATCGCCATCTACAACATGGCCTCA
GTCGACTTTGATGGCTTCTTTGCCGCCTTCCTCCCAGAGTTCCTGACCAGCTGTGATGGT
GTGGATGCCAACCAGAAAAGTGTGCTGGGGCGGAATTTCAAGATGGATCGG
gtgaggagagaaagaggccgggctaagaggagggcagagtgggcacgcaagcctggcacc
tgtgcagcaaggagggggcacattgaggcctctgggcgtggtctgtgcccaccctgcagc
ttggcggcagctcacgagatgcctgctgacctggtgctgtagcctgattgaggggcacag
EXON 24  661 bp
ctcccacagcgcctggcacagagtctctgtgacacgcagtgcaacagtgaatagaagttt
tgagttttagaaagtgctcccctatcttcagtgcacactctgggatggaagtagctgttg
gggtctggtgggtgggtgacctggtgtgttgttggctgcagctatgcccctgccttccag
GACCTGCCCTCATTCACCCAGAATGTGCACAGGCTGGTCAACGACCTGCGCTACTACAGA
CTCTGCAACGACAGCCTGCCCCCTGGCACTGTGAAGCTCTAGGCCTGCTACTGCCTGGGG
ACACGGACTTCTGCTGCTGCCACCTGCGCCAGCCCTACCTTCCACCACAGATGTCTCCCA
GATGGGCCTTGGTCACACTCCTTGGCTTCTCCCACCGCAAGCAACGCTGCCTGCCTCTGC
CGCTCCTCCACATCTTGCCGCTGCCCAGCAGAGCTGGCTTCTGGGTCCACCTGAGCACTG
GACGGTGCTCCCAGGGCGTTGGAGCAGGCGGAGGGGTGTGTGGCCAGGTACTAGGAGGCA
CCAGGAAATCCCGCGGGGTGGCCCATGCAGACCAGGCGCACGTGGCTCATGGGGCAGAAT
TGCCAAGGACAGCTCACGACAGTGCCACCTTCTCACCATTCCAGCCAAGGAGAGATGTGA
CGTTGGAACTGCTCTGGCACTTCTGTCAAGCCTCCCCCGCCCCAATTGCCTTGAGATCTC
TGCTCTTTGTCAGAGATTTGCAAAGACTCACGTTTTTGTTGTTTTCTCATCATTCCATTG
TGATACTAAGAAACTAAGAAGCTTAATGAAAAGAAATAAAATGCCTATGTTGTTGTTCTA
G
aaaccctggctggggagctgcttgctactcacagcctccttgaggccgggttcccagcaa
ggtgcatcctgatgggaatgtgggcagtgcggcttggagtgggctggctcctggcgtctc
ccaccttctaatggcatctccctgactgctcttactcagcgaggggagggggtctcactg