Gene WFDC1 Variant 1
DNA : 35.05 KbNT_024797
mRNA : 1377 bp NM_021197
CDS : 663 bp NP_067020
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  321 bp
aaggaagtgctcattatggagagtggagagtgacaggccactcccggccacgtctccaag
caagccggtgccccctcctcctgctgccaccgcccactgagctgcctgggctgcagacgc
cctggttggagcgtctggggccagatgttatagggcaagctaaaaataaccgggcaggcc
AGCCACCATCGAGGAAGGGGCATGTGCTGGACGCGGACACATGATCCGAGGGACCCTGCT
GGGTGGAACTAAGAAAGTCCAGCAGACTGTGCACGCTCCTGTCCCCACTCACAGGCCCAC
GCAGCGAGGGGGGCCCCTCTTCTGTGTGCGTCTGGAAGGTCGCTGCCCAGGGAGGAAATG
CCTTTAACCGGCGTGGGGCCGGGCAGCTGCAGGAGGCAGATCATCCGGGCTCTGTGCCTC
TTGCTACTTCTCCTCCACGCCGGCTCTGCCAAGAATATCTGGAAACGGGCATTGCCTGCG
AGGCTGGCCGAGAAATCCCGT
gtaagtgcctgggatggggaggctggggcagcctgtgtgggtgggagtcagccttgagga
gaggcgatccctagacactgccttctcctgtaagtgctcccccaaaacgtggcaaggcag
gcgtcttcctatccgtgtgtgtctgagttgtgtggtgggcagatggggctcacccccaaa
EXON 2  193 bp
tggtatcttctgaccttctgagccgccctccgaggctggctctgcctgcttgctgtttct
cacaagaggaaacgcaggctcagagaggcccggcgcactgcccacccccttgcaagctcc
gggtggcgccgggactcgaacgcgcgccccagagctgctgacaccgccctctccccgcag
GCCGAGGAGGCGGGCGCGCCCGGCGGCCCCCGGCAGCCCCGAGCAGACCGCTGCCCGCCG
CCTCCGCGGACGCTGCCCCCCGGCGCCTGCCAGGCCGCGCGCTGTCAGGCGGACTCCGAG
TGCCCGCGGCACCGGCGCTGCTGCTACAACGGATGCGCCTACGCCTGCCTAGAAGCTGTG
CCGCCCCCGCCAG
gtaggtcctgggcccgagggagggggctgagggaggaggacaggtgaacagagctgtccc
gggggaggggaagaaaggagctgggcttaaagctgggccacctgggcgggtctcgggcgc
ctccactgcgcacctgtgaactgggacgggcgctccttgagcaggcgtggcgctgctgtg
EXON 3  84 bp
cagcccacagtgaaaggttctatcactaaaagcaaagggtgaaggtgtgccaggaaccat
agttatttctcccatggggagcctctgtgctgtcatgaagttggggtgcccccagccccc
aagcctgggcgtttctcagctgcttgaggagggccctgatctgaccccgtattgtgttag
TCTTAGACTGGCTGGTGCAGCCGAAACCTCGATGGCTTGGTGGCAATGGCTGGCTCCTGG
ATGGCCCTGAGGAGGTGTTACAAG
gtacctgccgggtaaagcccagaccctacatccaagcctcgatccctccttctcagctgc
ttccagaaagctggcagcaccaggccggctgtcccccatgcacgggcccttcagccaaac
actcagccctctttgatcctccccaccccagcgaagaagggctgatggctgggggcttgg
EXON 4  141 bp
ccacatgccgctgagtgagacccagggcctagcctggaacctggggtacagaggcgaggc
cgcctctctgggtgaggtgcgttccctgcacccgtcccgggagtctgccttctagaccct
agcatgtgcacctgtcctgggagtcggccttctagaccccagcgtgtgtccctcctgcag
CAGAGGCGTGCAGCACCACGGAGGATGGGGCCGAACCCCTGCTCTGTCCCTCGGGCTATG
AGTGCCACATCCTGAGCCCAGGTGACGTGGCCGAAGGTATCCCCAACCGTGGGCAGTGCG
TCAAGCAGCGCCGGCAAGCAG
gtgagtgtggcaccccagccctgatcctggctcctgccccagtccccttctccctgtaag
cgcctctcacccgcatggacgacctgccccaggaagcagccccagcacctgggcctgact
gagagctcctcacatcttccccctgcccggctccttctttcatggcccctaccctttccc
EXON 5  42 bp
atcatattagaaactagagctgagacattacaaatgctcatgtagcctctgaacaattcc
attgtacactagtgagatggggagactgaaaaacacaagtaattcctcagtgttattatg
acaacagttttggccttctaaactcctaaaagaagttttttcctctcacttgttttccag
ATGGGCGAATCCTACGACACAAACTTTACAAAGAATATCCAG
gtaaaagaagaaactgttctttctttccagagggcacaaaaaaaaggcagtgaaagtttc
ttatgtgaagaaaaaaataaaagcccagggctgagatatagggaacaaaatgggacctgg
gattaagaaacaaaatagaagacctgtggtctgatggtgggcagggagttgtgagtcaca
EXON 6  74 bp
cagctggggggcctggggagggagaggaggcactgcaggtggggactgagtgacctcagc
tgggggagggaggagagggccaggtcaccaggcttcatttggcagttcctggtgagccac
ggggggcattagagcaggaatagatacatctaccccaacagagctgtgttcttttcacag
AAGGTGACTCAAAGAATGTGGCAGAACCTGGAAGGGGACAACAGAAGCACTTTCAGTAAA
GCAACGGCAAGCAG
gtgagtgggcagagagcaagagtcatggccagggtaaatgtgggcagccagtgtcctggc
agctttcaccaccaggttgaggagcaggagggtgagagtagcgctttccctactggtaga
atttgaaattcccttctgcagtaagtcctcacctaacgtcatcaataggttcttggaaac
EXON 7  522 bp
cagaattgggtcttctcagaaaggggcatcttcctggtgtttctgatggtggcggtggcg
gcggggagacgaaagatttgtgactctgtggtctgccctgcagtggttcaccctgaccct
tctttgtctctggtctgccctgcagcggttcaccctgatccttctttgcttgctttccag
CTAGGTTGCAAGAACATTCCTCTACTTTCTGCTAAGCCTTGGAAACAGTTGGGAAAAGTA
GTTTGACCCTCACAGTTCACATTCAGCTCAGCAGAGCAAGACCCCAGAGATGCTTAGAGA
CAGGACACCTGGCCATCAAACCCAGTTTGGCCCAGCCTGGTTGGGTGACTTTGTGGGAGC
CACTTAACAGCTCTGGGTCCCTGTTTTACCATCCTGGGAGCAAGGCCCTGCAGCTCCACG
AGACCTTTACCCCGGGAAGAAGCCGCCACCCATGAAAGCATTTCTGAAGCCCCTTTCTAA
GACAAGGCTCAGCATCTTGATATTTTTGACAGATTCCTCCCAAGTCTGGCTCTGGGAGGT
ATGTACCCATCTCAAATGTTCCCAAGATAAATTCATCCTTCAGGAAATGGAAATGAACTT
GCTTACTAATGTGTGATTCCTAGTTGTAGCCACCGGATGTGCTGAGGCCTAAATGTTAGC
AGGTGGGAGGAGGCCACAGAACAATAAAAACAACCAAATAAG
atgccgagtctctggtgttttgtgatactttgtcactgtttaattcaggggtgggaagca
gcgtgggtattgctgggatgaggtgtcagctaggctctgctcctggaaccctgtgttagc
atagagcccctgaagcagaccttgggagggggatttgttgaaagtgattcattagggcgg