Gene TSC2 Variant 2
DNA : 40.12 KbNT_037887
mRNA : 5414 bp NM_021055
CDS : 5295 bp NP_066399
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  156 bp
tgcctgtttgcgagctggtcagctgggctgtagttgagttctcccagggagtgtgggagg
aaaggttatgcccaccagagacccagggtcctgacggctggaggtccgcagtggggaagg
tgggcagaggtgttgctcagatgtccccattcctgtttcgtttgcacagaggggttttct
GGTGCGTCCTGGTCCACCATGGCCAAACCAACAAGCAAAGATTCAGGCTTGAAGGAGAAG
TTTAAGATTCTGTTGGGACTGGGAACACCGAGGCCAAATCCCAGGTCTGCAGAGGGTAAA
CAGACGGAGTTTATCATCACCGCGGAAATACTGAGA
gtgagtgagctacctgtgtctttgctaggctagagggaaatgcagagaaggctgggtttg
gtcttgcaccaggttctgtgggagacgggttgctggcaactgtctacacaggaatgctgt
ctccagtacttggaggccgacatgtccttcctcaggagacttcgaaagtcaggatcttgg
EXON 2  87 bp
gtgcagggattacaggcctgagccaccgcggctcgtcaagtgaatcttgattccagaaag
atctgttttaagtctctagtctggaaaatgcagtgggagtctttaggtggtttgtgactt
gcagttaaggagaccgtggcctgagcactggcccctttttcttctttcatctctctccag
GAACTGAGCATGGAATGTGGCCTCAACAATCGCATCCGGATGATAGGGCAGATTTGTGAA
GTCGCAAAAACCAAGAAATTTGAAGAG
gtaggtttatccagttgagctactagagagaggcacgtagactattcagagcctgagttt
gctttttttaggaacatggttgacagctgactgccgatgatctggtttgcactttttttt
tttttttttttttgagatggagtcttgctctgtcgcccaggctggcacaatcttggctca
EXON 3  111 bp
cgaagcctgtggtcatctcaggctgcaggagacacaggagatacgagctttggaggtggg
gctctcagtcacaagcccccgttgttcctccctgtcctccgctcacggcactgctccagt
tgccggggccagggttcttggagagcacatcctcaccgctgtcccctctgctggtgacag
CACGCAGTGGAAGCACTCTGGAAGGCGGTCGCGGATCTGTTGCAGCCGGAGCGGCCGCTG
GAGGCCCGGCACGCGGTGCTGGCTCTGCTGAAGGCCATCGTGCAGGGGCAG
gtaaggcccagggcgacgctgggatgggtgacgtcaggctgcccactgactgtcctgtcc
ctgctgggccgtgtttggactcctgcctcggtgagttgctgggcacagggtctaggggct
gatgggctctggagctggatggcctgtggggtctcctggtgtcatgaggtctgtgtgacc
EXON 4  145 bp
gcatccggccccctgccctgtacaatgctgatgctgcagacctgtctcttgcagggcgcc
tctgtgggaaggagaggggtccagggctggagtccgggtgcccctgcacttcagggactt
cttggcagccgtgtgggcgacgctggcaggctctgctgatcctgtggcttttgtctttag
GGCGAGCGTTTGGGGGTCCTCAGAGCCCTCTTCTTTAAGGTCATCAAGGATTACCCTTCC
AACGAAGACCTTCACGAAAGGCTGGAGGTTTTCAAGGCCCTCACAGACAATGGGAGACAC
ATCACCTACTTGGAGGAAGAGCTGG
gtgggtgccaccttgggttggaggtttctctggccttgacgatcaagtgtaacctggatg
ggaaggacctggggctggggaggggctgccgttctcagggatggcctgcagcgggtatgc
ccaccctgcttcatgcacctgggctcacctgcgtggccggagtgcccctgaggcacgtgt
EXON 5  118 bp
gccctgggctcccctgagcctcttcgggcccagtgcgtggtctgtctgttgctgccgggg
gactgatgatggggtttctggcagtgacgggtttggacacactgtcctgcggcgggaggg
ggaggtgagtgggagatgtagattcggcgtcctcgcaaactgccgccgcttctcccccag
CTGACTTTGTCCTGCAGTGGATGGATGTTGGCTTGTCCTCGGAATTCCTTCTGGTGCTGG
TGAACTTGGTCAAATTCAATAGCTGTTACCTCGACGAGTACATCGCAAGGATGGTTCA
gtaagaaaagaattgagatcctgttctgataatggtcctaagttcagctccgcagtgaat
aaagttgaaaccaccaaaaaaatagaggttgggctgggcacaatggctcacgcctgtaat
ctcagcactttgggaggccgaggcaggcggatcacgaggtcaggagttcgagaccagcct
EXON 6  49 bp
cccagcaccgagagcagtggctggcgcacagcaggcacctgagtgcttgttgggtgggtg
ggacccccagggaggatgagccatgcgtgttattgacgtcatagagtgactagaccacag
cccgtggtggctcggccatccaggcagtgctgccgggactgagctcggtgctccctgcag
GATGATCTGTCTGCTGTGCGTCCGGACCGCGTCCTCTGTGGACATAGAG
gtcagtgcctcccctccccagggccggcccatttcaccctggtttctgggaggctggggc
ttgggggttgagccctgtgtgccacctgctggctgtgtagccctgggcaagctgctcggt
ctctctgagcctcaggagtcccccatgtaagtcaggatagccgggcgcctccatgtggag
EXON 7  126 bp
tgacagggacgtcaggtgcttcccacatgcccgcttgccctgtggcttggagagagggtg
ccatggcagcggggagaggtggcagcgcaggctgaaggaggtgggaaggaagcctgggtg
tcctctcctgtggggaggagctggggtaggacgggcgtgagccgtctccctctccaccag
GTCTCCCTGCAGGTGCTGGACGCCGTGGTCTGCTACAACTGCCTGCCGGCTGAGAGCCTC
CCGCTGTTCATCGTTACCCTCTGTCGCACCATCAACGTCAAGGAGCTCTGCGAGCCTTGC
TGGAAG
gtggggtttctgaaactgctctggaaggttcctgagagcacatggatgggacaagggcca
tcctgtctcccatgaatggttgtctgattcttggggtggccagacaatggcctgttgagg
gacggccagtgtcattttcccaggcagttgagctgaggtcagggttttggtggcattttg
EXON 8  74 bp
aggtcagggttttggtggcattttgagaaccctgctgcctctgtctttgggaggagatgg
tggcgagctggccggaccttgggtggctatagggcagcagccaggcggggccagcagcgg
gactggggctgggggcagggcttatgcctgccagcccctgacacgcattgtgtctcgcag
CTGATGCGGAACCTCCTTGGCACCCACCTGGGCCACAGCGCCATCTACAACATGTGCCAC
CTCATGGAGGACAG
gtgagtgtggtgggtggggcgcagggcagtggaggccagcacagccctcggggcagctcc
agtgtcccttgccaagcacacactggcttagagagtccttgtcctctcgggcagctgttc
cagaggctgccactagagcgaggcccatgacttctaggatccagcccctgtcctctcctt
EXON 9  127 bp
gagtgaacaagagtgttactgctggcctctgttccctgcccttccccagcggtgctcctg
ccccccccaagcacagggacctctggggctgctgcaggagcctcggcaacctcacacatc
catggcggaccctgggacagggccctgctcacattccgtctctctggggaacacttttag
AGCCTACATGGAGGACGCGCCCCTGCTGAGAGGAGCCGTGTTTTTTGTGGGCATGGCTCT
CTGGGGAGCCCACCGGCTCTATTCTCTCAGGAACTCGCCGACATCTGTGTTGCCATCATT
TTACCAG
gtaaggcggtttctgtgtgcagtgagctggcaggaacgggagagctcccctcacgcctgc
ccacccatcccactgggggtcctgctgcgggggctgcggtggcatttctaggcctttcca
ggcagttgctttgcagctgggggtgaggtttggggccctttgtaggctttagtctttttt
EXON 10  144 bp
gctggagcatgtagaaacccctcctgggcgccccacctgctgtttctgcggcccctgata
aacgtgtggtgggcactgcgggctcaggcgtgctactctcggtcccaagggtgactggga
gggcgtcccacagcaagcaagcagctctgaccctgtgtgctggccgggctcgtgttccag
GCCATGGCATGTCCGAACGAGGTGGTGTCCTATGAGATCGTCCTGTCCATCACCAGGCTC
ATCAAGAAGTATAGGAAGGAGCTCCAGGTGGTGGCGTGGGACATTCTGCTGAACATCATC
GAACGGCTCCTTCAGCAGCTCCAG
gtggggtgggggcaggagctccggggagcaccgggaacccagacaggcaggctcggccca
ctcagaagatggtaccttgggccccatctctgggggtcccgcagagactgccagaaccgt
gttctctggtgattcgcagtggcgctcatccaccttccaccggagacaggtctgattttt
EXON 11  138 bp
gtctcaacccatgaggcccggagcggcctcagagggctgggggcgtctgtccccatgcgg
cccagagcggcctgagagggctgagggcgtctccatgcggtgggtgtgtagcgaggcctc
tggtgccaagtccatgtggggagtggaagtcagcctgtgtcatcgtgcctggtactgcag
ACCTTGGACAGCCCGGAGCTCAGGACCATCGTCCATGACCTGTTGACCACGGTGGAGGAG
CTGTGTGACCAGAACGAGTTCCACGGGTCTCAGGAGAGATACTTTGAACTGGTGGAGAGA
TGTGCGGACCAGAGGCCT
gtgagaccccctcctgggtggggcctttgggctttggctggtggggaggggccgggtgct
gggtgaagtgcagctttctgagcctcagaagccaagggccaggtgggcgcctgctttcca
ggtttctgcactcggcagggaaggctggcaggcacagcacgtgtttggtaacaagctcgg
EXON 12  104 bp
tccatgggtttggacacaagtcttccccgctgccaggagtgcctttgtgtctgggctgtg
ggctgcaggctgtgaggcggctgggctctgacagcaaaccagcctctcgaccagcagccc
agtgtggagaaggagagcgccggaggggcagaggggcaacaccggctcttcttttgacag
GAGTCCTCCCTCCTGAACCTGATCTCCTATAGAGCGCAGTCCATCCACCCGGCCAAGGAC
GGCTGGATTCAGAACCTGCAGGCGCTGATGGAGAGATTCTTCAG
gtagggggtcctctgtagccttgcctggcacctggagcctggccctgtctctgtctgggg
cccacccgggctgggtctcaggatgcccgatgagcagggccctcccctctgcctctggag
agccctggctctgggtgagcaggtgctagcttgctttccagtccagcaggacaggtcctc
EXON 13  82 bp
ctgggctccctcttttcgggggtcgtctggagagatgctccctgggaagcagagctctgt
gccctgtgtgcctggccgcgggaggacccagagtcgggctggcctgcgccaggcagacgg
gctggtgtggggctgtggccgggcactccccacccgccccagcaggctgccgtcccgcag
GAGCGAGTCCCGAGGCGCCGTGCGCATCAAGGTGCTGGACGTGCTGTCCTTTGTGCTGCT
CATCAACAGGCAGTTCTATGAG
gtgcgtgtccaggcggccgcagctgggggctcagggctatttctccgtgggcgggctgtc
tctgttgtgcacgtgctcccgcagagccgggctctgcctgggacttcggtcctgccggac
cctctgcagcccccagcgtggtctgtttacccctgttcattcactggcttgctcgtcctg
EXON 14  156 bp
ggaaggggccccggggtctctgagtcgcgctcagcgggtgcttgtgctctctgcccagct
gtgctgaagtcccgagggacatgtccgctgcttgcgggtcggttcctgaggaattggaag
tgtcacgagatgtggccctcgttgggctggcgctcattggcctcccttgtgcctgtgcag
GAGGAGCTGATTAACTCAGTGGTCATCTCGCAGCTCTCCCACATCCCCGAGGATAAAGAC
CACCAGGTCCGAAAGCTGGCCACCCAGTTGCTGGTGGACCTGGCAGAGGGCTGCCACACA
CACCACTTCAACAGCCTGCTGGACATCATCGAGAAG
gtgagagccgttgtacccggggccgggtgctagcgtgccagagctccgtgggcagcaatg
gcctctgggccctctgtcctcctcttcgagtgaccggatggctgtgtccgtaggtgaggc
tcccctccctgcagggtgggtgtcccgaggcctgtgcagggcctgccactgctggatttg
EXON 15  117 bp
ggaggcggagcttgtagtgagctgagattgtgccaccgcactccagcctgggcgacagag
caagactcgatctcaaaaaaaaaaaaaaaaaaaaaaaaggtgtttgtggtagaaagtgtt
ctcacggctgctgactcagaaccatgagcctgtgtgtaagtcctggccttctcttcaaag
GTGATGGCCCGCTCCCTCTCCCCACCCCCGGAGCTGGAAGAAAGGGATGTGGCCGCATAC
TCGGCCTCCTTGGAGGATGTGAAGACAGCCGTCCTGGGGCTTCTGGTCATCCTTCAG
gtgggtgttctgcacgaggcctctgctcccggggcgcgcatggctagcgtccaccagctg
catctgcgttgtgttggagtctgttccccagcgggacccacaccctccctggatttgctg
agggtgcggtggtctcagcaggcagcagaaccttcctcctgctcttgtggagggatggat
EXON 16  123 bp
tgggttttactttttgctgctgtggagagagagtcctggtggtcctgggtttgaaggtcg
tgtgttttgaagcacgcactctagagcagccgccccggcccctgctccgggacaagggtg
ctgtcttaggactgcgttttcacctcctgcgccgtggtgagctgcgtcctctctctgcag
ACCAAGCTGTACACCCTGCCTGCAAGCCACGCCACGCGTGTGTATGAGATGCTGGTCAGC
CACATTCAGCTCCACTACAAGCACAGCTACACCCTGCCAATCGCGAGCAGCATCCGGCTG
CAG
gtatggtggctggggttgcgcagccagttcctgggggcccagccaggtatccccgtctcg
gcaggtgtggttcctggaagctgcagagacggccccaggatggggcctcagctgaccgtc
cctcctctgcacccactgtggccgcagcctccccagtcctggtgtccttccctctgcctg
EXON 17  107 bp
gggcctccggtgtcaccaggacagagcctgtgtctgtgttgggatgtgggtgtgtgcaca
tcagcaggtggccttttctgagtgcctgtggtgctggacgtgggtctgagcaggtgggac
gccgcctgtcctgggcctgcacgagcttggctctggctttcaccatcctcttcctgacag
GCCTTTGACTTCCTGTTGCTGCTGCGGGCCGACTCACTGCACCGCCTGGGCCTGCCCAAC
AAGGATGGAGTCGTGCGGTTCAGCCCCTACTGCGTCTGCGACTACAT
gtacgcgggacctcgcccacggcccatgaggctcagggcgtcagaggcgctggggctgtg
gtggcgctgtttgcatgtctgagggatgtcccagggttgggaagagccaagtctgttccg
ttcctgctgcggggacttggcctcagctgcttctcttgcttctgcagggagccagagaga
EXON 18  151 bp
tctgcgactacatgtacgcgggacctcgcccacggcccatgaggctcagggcgtcagagg
cgctggggctgtggtggcgctgtttgcatgtctgagggatgtcccagggttgggaagagc
caagtctgttccgttcctgctgcggggacttggcctcagctgcttctcttgcttctgcag
GGAGCCAGAGAGAGGCTCTGAGAAGAAGACCAGCGGCCCCCTTTCTCCTCCCACAGGGCC
TCCTGGCCCGGCGCCTGCAGGCCCCGCCGTGCGGCTGGGGTCCGTGCCCTACTCCCTGCT
CTTCCGCGTCCTGCTGCAGTGCTTGAAGCAG
gtgagtggggccgggcagggaccatccgtcccacgttgggccaggaggacagggagctgc
cacctgcctgctgggcctccctccctgtctggcctgtggagggcagccctccctcagagc
tgagccttcccccttccccgagcagctgcagggacagaggcctgcgctgggcaggctccc
EXON 19  123 bp
ttcccccttccccgagcagctgcagggacagaggcctgcgctgggcaggctcccccggct
gagaacagggctccatagcccttgacgctgtgcagccacaaagcagagcctcagatgcta
gcttccgcctctgtctctagggtccagaaggccctgtcctgacgcctcctctcctcgcag
GAGTCTGACTGGAAGGTGCTGAAGCTGGTTCTGGGCAGGCTGCCTGAGTCCCTGCGCTAT
AAAGTGCTCATCTTTACTTCCCCTTGCAGTGTGGACCAGCTGTGCTCTGCTCTCTGCTCC
ATG
gtaccatggccggcctggggttggggtgggggacccagtagggtttttccccaaaagact
gcgagcctctgggcagagcgagtgagacccttcgggctcgggctccatttccctcaaact
cagctgcactctggagcgcagattgtgccttgggcagggtggagggacccctgccccagc
EXON 20  135 bp
tacttggcaggcactcccaccactccgaaagggaggcccttcctgggagggaggcaagaa
ggctccccagcccctttgccccctttcctgggcctgcgttcccagggcctccccagcccc
tctggctaccccgtgacctggccgctggggagaggtttcatgcctggatttggtcatcag
CTTTCAGGCCCAAAGACACTGGAGCGGCTCCGAGGCGCCCCAGAAGGCTTCTCCAGAACT
GACTTGCACCTGGCCGTGGTTCCAGTGCTGACAGCATTAATCTCTTACCATAACTACCTG
GACAAAACCAAACAG
gtaggaggtcagagcaggacaggcgagcttgatggggcctgggattcgagggcctggccc
aggtaggccccacatttttctcataaacgagtttctgccaggccagggatgagtgagttg
gctctgcttccctgggtggctgccagatgcccagagtggggacatccgattccctggtgc
EXON 21  190 bp
agcagtctgctgtgcagagtctgctcgggtagctcagcactgctggctctgccccacagg
cattcagggacttgctaagcctcggctgttctcccggtggagcactcgaggttggcgagg
ggtaggcgaggctgcctctgctgcaagcgggtggggcctgaggtgtcctgtctcctgcag
CGCGAGATGGTCTACTGCCTGGAGCAGGGCCTCATCCACCGCTGTGCCAGCCAGTGCGTC
GTGGCCTTGTCCATCTGCAGCGTGGAGATGCCTGACATCATCATCAAGGCGCTGCCTGTT
CTGGTGGTGAAGCTCACGCACATCTCAGCCACAGCCAGCATGGCCGTCCCACTGCTGGAG
TTCCTGTCCA
gtgagtccccgccctgcctgcgcatgcacccgagaggttcgggctgtgtaacctgtgcgg
gcttctctggtgccctctctcaggactccttggggaacctgggtgtctcgccttctgctg
cctcagggcctgggcgtctctgcccggctgccatgagtgctctccttcctggctttgagg
EXON 22  94 bp
gtggttggctggccatgggaccgagagttgaggccagggtcgggaaagccacgtccgtgt
ggccgtggccttctctcctctgcagcaccccatcgctgccgtgggcagagcagccgtgtt
ggccttcagaggcgctgcacgggaccccggctcccctgaccaccctctccattaccgcag
CTCTGGCCAGGCTGCCGCACCTCTACAGGAACTTTGCCGCGGAGCAGTATGCCAGTGTGT
TCGCCATCTCCCTGCCGTACACCAACCCCTCCAA
gtgagtggtcgccccaggccctgtgcctcccagccgtggcccccgctaggccttgcggca
gaaagccccggcagcctttgtccccaaggcctgagcgcctcggttttttgcacttcatgc
cctggggatgtttccctgctgccaggatggagtgccagcccccttctcatctcaggttta
EXON 23  103 bp
tccaagtgagtggtcgccccaggccctgtgcctcccagccgtggcccccgctaggccttg
cggcagaaagccccggcagcctttgtccccaaggcctgagcgcctcggttttttgcactt
catgccctggggatgtttccctgctgccaggatggagtgccagcccccttctcatctcag
GTTTAATCAGTACATCGTGTGTCTGGCCCATCACGTCATAGCCATGTGGTTCATCAGGTG
CCGCCTGCCCTTCCGGAAGGATTTTGTCCCTTTCATCACTAAG
gtgggctcagggccggtgaaggctgtgtctctcggtaggccagggcttgctttgcccttg
gctgtccatggtcgggcagagtgacaggcaggtggagggcagtgggagggtgtttggggc
tgtgcctgtggcgctgggggctctgctgggcagcctgcagggctttgatgcgcggcaggc
EXON 24  95 bp
ctctgctgggcagcctgcagggctttgatgcgcggcaggcattgaggggtgggagctggg
tgccgccgccttgcccctagcctgcagcttgtccctggccagggggcacccggcaggcct
ggtgagggcctccagcccccattgccacccctcactgtctgggtgtgctcactctgccag
GGCCTGCGGTCCAATGTCCTCTTGTCTTTTGATGACACCCCCGAGAAGGACAGCTTCAGG
GCCCGGAGTACTAGTCTCAACGAGAGACCCAAGAG
gtacggcctgcgggggtgtgcctggagtcggtgtggggtggggaaggacatggggctgtg
gcctgcctgacggtgcctccaagtcagtgagtggaaatgggtcctgtgtgccctggagta
tgtgaggcagggcaggacctgcaagggccgctaacacccctcagcccctcagcaggttgg
EXON 25  165 bp
tctgggacaatgtggtccacgtgattctcaagctgaggctcgctgggccgcccacgccct
gttggggtctttccgagcgaggtcctcagccgtgcatgcgttgagctttggcccttggtg
ataggtggctcggcccgccctacctggcaccctgaccctggtcacggcctctccctccag
CAGGATACAGACGTCCCTCACCAGTGCCAGCTTGGGGTCTGCAGATGAGAACTCCGTGGC
CCAGGCTGACGATAGCCTGAAAAACCTCCACCTGGAGCTCACGGAAACCTGTCTGGACAT
GATGGCTCGATACGTCTTCTCCAACTTCACGGCTGTCCCGAAGAG
gtccaggcggcactacagggctgggcgggcctgcgggagctccacgggcaagctgggttt
cacgctccctgtcttctaggtctcctgtgggcgagttcctcctagcgggtggcaggacca
aaacctggctggttgggaacaagcttgtcactgtgacgacaagcgtgggaaccgggaccc
EXON 26  153 bp
gctgacgatagcctgaaaaacctccacctggagctcacggaaacctgtctggacatgatg
gctcgatacgtcttctccaacttcacggctgtcccgaagaggtccaggcggcactacagg
gctgggcgggcctgcgggagctccacgggcaagctgggtttcacgctccctgtcttctag
GTCTCCTGTGGGCGAGTTCCTCCTAGCGGGTGGCAGGACCAAAACCTGGCTGGTTGGGAA
CAAGCTTGTCACTGTGACGACAAGCGTGGGAACCGGGACCCGGTCGTTACTAGGCCTGGA
CTCGGGGGAGCTGCAGTCCGGCCCGGAGTCGAG
gtgactgcaccttcctttcctccgcgcctgccagcctcgacaccggctgtcccgagccca
ggcccacgtggcaccctcgtaccagcctggggactaagtccaccctgtgcgtgggattct
cttctcagctccagccccggggtgcatgtgagacagaccaaggaggcgccggccaagctg
EXON 27  113 bp
ggtcgttactaggcctggactcgggggagctgcagtccggcccggagtcgaggtgactgc
accttcctttcctccgcgcctgccagcctcgacaccggctgtcccgagcccaggcccacg
tggcaccctcgtaccagcctggggactaagtccaccctgtgcgtgggattctcttctcag
CTCCAGCCCCGGGGTGCATGTGAGACAGACCAAGGAGGCGCCGGCCAAGCTGGAGTCCCA
GGCTGGGCAGCAGGTGTCCCGTGGGGCCCGGGATCGGGTCCGTTCCATGTCGG
gtgagccttggccccagccacctccacacaggcaccggggctccctcagttgctgctggt
cccagtgttcaggaaggccccgagcccaggggccggggtggctggcttcaggcccggccc
acgtcctgactctggggtgagccttccacagctcaccccagagccgtggagtggtggagt
EXON 28  213 bp
ctgtggccctgggttcactgaggccagcactgtggtgggccgtgccccaagggcagagct
gccaccgtctctggctgcctgtggcactagcttgccaggctcggggggagcattcagctt
gaggctggtggttttgcatcaggtaagtggtggtcaccagtcctctgccctcttcttcag
GGGGCCATGGTCTTCGAGTTGGCGCCCTGGACGTGCCGGCCTCCCAGTTCCTGGGCAGTG
CCACTTCTCCAGGACCACGGACTGCACCAGCCGCGAAACCTGAGAAGGCCTCAGCTGGCA
CCCGGGTTCCTGTGCAGGAGAAGACGAACCTGGCGGCCTATGTGCCCCTGCTGACCCAGG
GCTGGGCGGAGATCCTGGTCCGGAGGCCCACAG
gtactgggcggggctggcctgagcgccatctttctgccagtcacccacagagctgtggac
actcaggggcgattgcagacttggccctcttgggatatttgggggtaacttttgtttttt
ttttgagacagagtcttgctctgtggcccacgctggaacgcagtggcgcaatctcggctc
EXON 29  204 bp
tgagcggggcagcagggtgggtggccgtcagagcagcgctggctccgacatcgtggtcct
gaggattgtgggagggagcatgagggcaaaaccagggcccaggccaggaggcccctgggg
ggccagagatgggtaaggggaggtactggcctcaggccaaaggtgctgccgcctccgcag
GGAACACCAGCTGGCTGATGAGCCTGGAGAACCCGCTCAGCCCTTTCTCCTCGGACATCA
ACAACATGCCCCTGCAGGAGCTGTCTAACGCCCTCATGGCGGCTGAGCGCTTCAAGGAGC
ACCGGGACACAGCCCTGTACAAGTCACTGTCGGTGCCGGCAGCCAGCACGGCCAAACCCC
CTCCTCTGCCTCGCTCCAACACAG
gtgagtggcatggcgggccttggcacgggctctgctcccactggcctggtgctcccggtg
acggcaatgtggctcctctctgctgagggcgcccacacggctgggagtggtccctggcct
gcctcagcaccattgttctccggtgtttgggaggaggctgacccgtgggaggtgtctgcc
EXON 30  69 bp
ggcactgccctcctcaggtctgcccaagcagcttgtagctagcactgggccccgtgcgcg
cccctgccggccgctggccctgccctctctcctctgcaggcacggggcctgtgctctctg
ctcgacctgtgtgtagcccctcctcctgctgacgtggccgcacacggccttcccttgcag
TGGCCTCTTTCTCCTCCCTGTACCAGTCCAGCTGCCAAGGACAGCTGCACAGGAGCGTTT
CCTGGGCAG
gtatcgcctctcagagggaagcggttggctgcagagcgccactctgcctcataggtgctg
tgctcgtcgcctcatccgcccacccccatggtccgtctgcctccattgccctggggagca
ggtcccgactcgcatgaggacgtctgtgcagaatgtctttggcttggccagcgggatccc
EXON 31  122 bp
gtgcaggccttcccagcgtcctccctgcccgctcggtggatggcagcagtaagcagagcc
ctggggaggctcgcagggctgctgtccctctggtcaggagaaggctggttctcggaggcc
acgtcagggccagggcctggcccagccccacatccagcagccccgtctgtgtcctcccag
ACTCCGCCGTGGTCATGGAGGAGGGAAGTCCGGGCGAGGTTCCTGTGCTGGTGGAGCCCC
CAGGGTTGGAGGACGTTGAGGCAGCGCTAGGCATGGACAGGCGCACGGATGCCTACAGCA
GG
gtgagtgtggctcagagcctggaccctgctgacctcggggggctccttaggggaggcagg
gctctgcgtgggtgtgcctgcaccctgggaactggctctgaacttgggggagatgttctt
ccacatccctcgtgcacagacggtctgcactttgcagccatccacctgggccggccctgg
EXON 32  488 bp
tgtggggcacagctggtggcagtgctgctgcgtcaacgggcgggggccgtagcctggtgc
tcgggctggtctgtggccctgggatggaggacagatagggcctcaccacctccaggtcaa
ccccaggtgggctcgagggtgcctgctgacaggggttctctttgggatggtcctttctag
TCGTCCTCAGTCTCCAGCCAGGAGGAGAAGTCGCTCCACGCGGAGGAGCTGGTTGGCAGG
GGCATCCCCATCGAGCGAGTCGTCTCCTCGGAGGGTGGCCGGCCCTCTGTGGACCTCTCC
TTCCAGCCCTCGCAGCCCCTGAGCAAGTCCAGCTCCTCTCCCGAGCTGCAGACTCTGCAG
GACATCCTCGGGGACCCTGGGGACAAGGCCGACGTGGGCCGGCTGAGCCCTGAGGTTAAG
GCCCGGTCACAGTCAGGGACCCTGGACGGGGAAAGTGCTGCCTGGTCGGCCTCGGGCGAA
GACAGTCGGGGCCAGCCCGAGGGTCCCTTGCCTTCCAGCTCCCCCCGCTCGCCCAGTGGC
CTCCGGCCCCGAGGTTACACCATCTCCGACTCGGCCCCATCACGCAGGGGCAAGAGAGTA
GAGAGGGACGCCTTAAAGAGCAGAGCCACAGCCTCCAATGCAGAGAAAGTGCCAGGCATC
AACCCCAG
gtgggcctcttgcttccgggcggggctcctgacacctctcctgcgggaacctggtgcctc
acttgccccaggccgagcgggctggggtggggtcctcgcctgtgccctagggctggctgg
aacccctgggagggcggtggagtgggagatggccaggctctgtgttcctccctgtgggct
EXON 33  76 bp
gcctcacttgccccaggccgagcgggctggggtggggtcctcgcctgtgccctagggctg
gctggaacccctgggagggcggtggagtgggagatggccaggctctgtgttcctccctgt
gggctgtggctgccctggccaggccctcacctgggtgcccaccatcccctccctgtgcag
TTTCGTGTTCCTGCAGCTCTACCATTCCCCCTTCTTTGGCGACGAGTCAAACAAGCCAAT
CCTGCTGCCCAATGAG
gtaggcgtggcctccctctcctgcatccgctggagctgtgtggctcgggtgaatggtggg
gggcccagctctgctgctgggagctcaggcttgcagagggctctggcctaagctccctgt
ggcagcctgccgtgaccggcctgggtggggcggcctcctgtggacgggcgtctggggctc
EXON 34  93 bp
catccgctggagctgtgtggctcgggtgaatggtggggggcccagctctgctgctgggag
ctcaggcttgcagagggctctggcctaagctccctgtggcagcctgccgtgaccggcctg
ggtggggcggcctcctgtggacgggcgtctggggctcaggcagggctctgtgtgccacag
TCACAGTCCTTTGAGCGGTCGGTGCAGCTCCTCGACCAGATCCCATCATACGACACCCAC
AAGATCGCCGTCCTGTATGTTGGAGAAGGCCAG
gtgaggctgcggggccggcctaggtgcctggacagggccagctgggcctcagcctgcagt
gggtagggagtctgggcccccaacgccccacagagctcaacactgccgggtcccctacag
catgaagtgctcattgagctctgtgccaggtgctgctctgagtgctggggaccccggtgc
EXON 35  187 bp
agagagggagtcaaggatgacacccgatgtctggcctgggtggctgctggaatggatggt
cttgtctgcctcagggatcagagtggggctcccggcagagcctgctgggcacccccaccc
tctgcggggcagggcccggcccgggagtgatgccaccctgcctctcccctctccccacag
AGCAACAGCGAGCTCGCCATCCTGTCCAATGAGCATGGCTCCTACAGGTACACGGAGTTC
CTGACGGGCCTGGGCCGGCTCATCGAGCTGAAGGACTGCCAGCCGGACAAGGTGTACCTG
GGAGGCCTGGACGTGTGTGGTGAGGACGGCCAGTTCACCTACTGCTGGCACGATGACATC
ATGCAAG
gtacggcctggcgcctacccgctcctgctgccccaggcctcagggcacggctcccatcca
gtcctgctaccccacgccctggggcatggccctggcacccccacctgctccagctcccca
cgcctcaggttccgagcctaacagcgtgggcatggaggcagtgatggggctggtggcttt
EXON 36  140 bp
gtggctttgcgtcccaaagccctgcccctggggagagccgaggaccactggccaggcacc
agaggacgtggtccccgcaggcccccagagcccctggagtaatcaggaggtgccccagtg
caaggcacagagggcctcagcactggccccacaaacccatccggccctgctcaccctcag
CCGTCTTCCACATCGCCACCCTGATGCCCACCAAGGACGTGGACAAGCACCGCTGCGACA
AGAAGCGCCACCTGGGCAACGACTTTGTGTCCATTGTCTACAATGACTCCGGTGAGGACT
TCAAGCTTGGCACCATCAAG
gtgagtgaggggccgtcagtgaggctgggccccaggcaggtgcccactgctgtgtcccgg
gttggtggcaggtcctcctccctgagcttcggtcacgaggagcaggaggagaggccgcag
tgctcagggccccgtgggcacgagcttcaccccgagcctgcgttgtgtcctctgtgccct
EXON 37  79 bp
tggagggggcttggcctgggggaggccagacaaacacagccccgctgccagaggggaaag
ttcaggggcagatgctgcccatggagctgacaggtgtctagcagtgcaaccaggcagtag
ccgagatcagccttcagcacacgctgtgtgcggggatgaccctttctcttgtccgggcag
GGCCAGTTCAACTTTGTCCACGTGATCGTCACCCCGCTGGACTACGAGTGCAACCTGGTG
TCCCTGCAGTGCAGGAAAG
gtagggccgggtggggccctgcagtgcaggaaaggtagggccgggtggggccctgcagtg
tggcgccaagagccctgggcctggcgtgaccaccaagtctccccagacatggagggcctt
gtggacaccagcgtggccaagatcgtgtctgaccgcaacctgcccttcgtggcccgccag
EXON 38  92 bp
gttcaactttgtccacgtgatcgtcaccccgctggactacgagtgcaacctggtgtccct
gcagtgcaggaaaggtagggccgggtggggccctgcagtgcaggaaaggtagggccgggt
ggggccctgcagtgtggcgccaagagccctgggcctggcgtgaccaccaagtctccccag
ACATGGAGGGCCTTGTGGACACCAGCGTGGCCAAGATCGTGTCTGACCGCAACCTGCCCT
TCGTGGCCCGCCAGATGGCCCTGCACGCAAAT
gtgagtgggggtgggtccaggcgtgagctggtgggacaggcccaggtgccacctgatagt
gagctcaccccctgcctacgtccccagatggcctcacaggtgcatcatagccgctccaac
cccaccgatatctacccctccaagtggattgcccggctccgccacatcaagcggctccgc
EXON 39  99 bp
gacatggagggccttgtggacaccagcgtggccaagatcgtgtctgaccgcaacctgccc
ttcgtggcccgccagatggccctgcacgcaaatgtgagtgggggtgggtccaggcgtgag
ctggtgggacaggcccaggtgccacctgatagtgagctcaccccctgcctacgtccccag
ATGGCCTCACAGGTGCATCATAGCCGCTCCAACCCCACCGATATCTACCCCTCCAAGTGG
ATTGCCCGGCTCCGCCACATCAAGCGGCTCCGCCAGCGG
gtagggaatatggggctccctcagcggggtgtgctggctgcccaagctgtggggcgggtg
tgtgggcagagcggttgccacgcctcccagacttactgcccaagccgcctctgccttcag
atctgcgaggaagccgcctactccaaccccagcctacctctggtgcaccctccgtcccat
EXON 40  266 bp
gatatctacccctccaagtggattgcccggctccgccacatcaagcggctccgccagcgg
gtagggaatatggggctccctcagcggggtgtgctggctgcccaagctgtggggcgggtg
tgtgggcagagcggttgccacgcctcccagacttactgcccaagccgcctctgccttcag
ATCTGCGAGGAAGCCGCCTACTCCAACCCCAGCCTACCTCTGGTGCACCCTCCGTCCCAT
AGCAAAGCCCCTGCACAGACTCCAGCCGAGCCCACACCTGGCTATGAGGTGGGCCAGCGG
AAGCGCCTCATCTCCTCGGTGGAGGACTTCACCGAGTTTGTGTGAGGCCGGGGCCCTCCC
TCCTGCACTGGCCTTGGACGGTATTGCCTGTCAGTGAAATAAATAAAGTCCTGACCCCAG
TGCACAGACATAGAGGCACAGATTGC
agtcagacagctcttttattgactttgtctgcttggtgcgggggttgggggggtgtcgag
gctctagaagcggccatgcccacagaagtggtacacagaagcaggcacagccagctccga
gggccttgaggctgcctgggccatacagcacactcgcgcgtgcgcgcgcgcacacacaca