Gene TNFRSF17 Variant 1
DNA : 2.96 KbNT_010393
mRNA : 994 bp NM_001192
CDS : 555 bp NP_001183
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  348 bp
cacagagtacagcttattaacagatgttccagaaactgttactgaacattcggcttgatg
ctgtgggcttgtctgcatcttgcaactgtcacctggctgagaaatttcttctataaataa
gcagtttctgtttcagatgtgatatgccctgatatttacaccctgtctcttaccccatcc
AAGACTCAAACTTAGAAACTTGAATTAGATGTGGTATTCAAATCCTTAGCTGCCGCGAAG
ACACAGACAGCCCCCGTAAGAACCCACGAAGCAGGCGAAGTTCATTGTTCTCAACATTCT
AGCTGCTCTTGCTGCATTTGCTCTGGAATTCTTGTAGAGATATTACTTGTCCTTCCAGGC
TGTTCTTTCTGTAGCTCCCTTGTTTTCTTTTTGTGATCATGTTGCAGATGGCTGGGCAGT
GCTCCCAAAATGAATATTTTGACAGTTTGTTGCATGCTTGCATACCTTGTCAACTTCGAT
GTTCTTCTAATACTCCTCCTCTAACATGTCAGCGTTATTGTAATGCAA
gtaagtaatattgcttgaacgattattcattggtgtgaactattctgtctatatggactg
cttattcagagaatcaacataatgggcatgatggtgagttttcttgaatcaaaaagagaa
aggaagcaaggcagtgattttaatgtttatggaaacaaagtaattatttggaactgaact
EXON 2  147 bp
gcaggagaattgtttgaacttgggaggtggaggttgcagtgagccgagatcgcgccactg
cactctagcctgggcaacagagcaagactttgtctcaaaataaataaataaataataaca
ataaagtatgtgaatattatgttatcagctcattatctgtctgatgttcttttcataaag
GTGTGACCAATTCAGTGAAAGGAACGAATGCGATTCTCTGGACCTGTTTGGGACTGAGCT
TAATAATTTCTTTGGCAGTTTTCGTGCTAATGTTTTTGCTAAGGAAGATAAACTCTGAAC
CATTAAAGGACGAGTTTAAAAACACAG
gttggtttgatggtgaatctttgaaatctatttccaggggatggctattgtgagtttcag
ttccttttctttttttagcgttgactatttcacttcgttacagccctttcgaatgtgtta
gaacattgttacattaaatgaacttggtagaggtgagccatcttcattctgattttgaca
EXON 3  499 bp
tgggaggattgcttgagcccaggagtttgaatgcagcctgggcaacacagtaagacccca
cctctaaaaaatgaaaaaatctctctcacattgctttgagtcccgatgtgtactgctaag
actctcatgaccacattctctgtgaagtttgggttaatgtttccgtttctacataattag
GATCAGGTCTCCTGGGCATGGCTAACATTGACCTGGAAAAGAGCAGGACTGGTGATGAAA
TTATTCTTCCGAGAGGCCTCGAGTACACGGTGGAAGAATGCACCTGTGAAGACTGCATCA
AGAGCAAACCGAAGGTCGACTCTGACCATTGCTTTCCACTCCCAGCTATGGAGGAAGGCG
CAACCATTCTTGTCACCACGAAAACGAATGACTATTGCAAGAGCCTGCCAGCTGCTTTGA
GTGCTACGGAGATAGAGAAATCAATTTCTGCTAGGTAATTAACCATTTCGACTCGAGCAG
TGCCACTTTAAAAATCTTTTGTCAGAATAGATGATGTGTCAGATCTCTTTAGGATGACTG
TATTTTTCAGTTGCCGATACAGCTTTTTGTCCTCTAACTGTGGAAACTCTTTATGTTAGA
TATATTTCTCTAGGTTACTGTTGGGAGCTTAATGGTAGAAACTTCCTTGGTTTCATGATT
AAACTCTTTTTTTTCCTGA
catctaagtttttattaacgtgagtttttaaaaacaagcatgtataccagtgtggggggt
gagggtgggagagaaaggtgggagggggaaagaattctaacctattgataataaagctcc
agttttggccaggcgcggtggctcatgcctgtaatcccagcactttgaaaggccgaggcg