Gene SLC7A5 Variant 1
DNA : 39.47 KbNT_019609
mRNA : 4542 bp NM_003486
CDS : 1524 bp NP_003477
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  610 bp
ggcctgggaatagcccgccaggctgggccggacgacgcacgtgctccgagctgggccgag
ggggcggggctgagggacggggccgggccacggggcggggaggagccgcggacggtgggc
ggggccggcgggccggggcctaaaaggcggcgcgggcggggttcctgacgcagctgcggg
CGGCGGGCGGCGCGCACACTGCTCGCTGGGCCGCGGCTCCCGGGTGTCCCAGGCCCGGCC
GGTGCGCAGAGCATGGCGGGTGCGGGCCCGAAGCGGCGCGCGCTAGCGGCGCCGGCGGCC
GAGGAGAAGGAAGAGGCGCGGGAGAAGATGCTGGCCGCCAAGAGCGCGGACGGCTCGGCG
CCGGCAGGCGAGGGCGAGGGCGTGACCCTGCAGCGGAACATCACGCTGCTCAACGGCGTG
GCCATCATCGTGGGGACCATTATCGGCTCGGGCATCTTCGTGACGCCCACGGGCGTGCTC
AAGGAGGCAGGCTCGCCGGGGCTGGCGCTGGTGGTGTGGGCCGCGTGCGGCGTCTTCTCC
ATCGTGGGCGCGCTCTGCTACGCGGAGCTCGGCACCACCATCTCCAAATCGGGCGGCGAC
TACGCCTACATGCTGGAGGTCTACGGCTCGCTGCCCGCCTTCCTCAAGCTCTGGATCGAG
CTGCTCATCATCCGGCCTTCATCGCAGTACATCGTGGCCCTGGTCTTCGCCACCTACCTG
CTCAAGCCGCTCTTCCCCACCTGCCCGGTGCCCGAGGAGGCAGCCAAGCTCGTGGCCTGC
CTCTGCGTGC
gtgagtacggggcgcgggccgggggttgggaggtcgtagtctctgggtccctgcatcctt
gcatcactacgcccctggctcccacatctctacatctttacgttcctggaccatcccggc
agttctaggctaaggtcattggtcccagaaaccacgtgcgtttctttcattcattctttt
EXON 2  126 bp
aacaggtctcagaaagtcagaacgtgccctaagggctggcaggggactggagctgtttaa
ggagcttgtttttctggtggacctggccctggggtgggggtggggtcgtcacctcccagc
ctacccctgagctggcgtctgtctgcccgtggaactcaccgctgccctctgtctccacag
TGCTGCTCACGGCCGTGAACTGCTACAGCGTGAAGGCCGCCACCCGGGTCCAGGATGCCT
TTGCCGCCGCCAAGCTCCTGGCCCTGGCCCTGATCATCCTGCTGGGCTTCGTCCAGATCG
GGAAGG
gtgagtacgtcccccaggccccaccggcggcccctcgaggctttgcctgtgtgtccttca
cagggcatgaggtcccgtccccgggtgcctcccagtccgcagctctgcagtgctgtacaa
cgtggagatttccctctgggaaaatcacccagcaagtgaaatccgacccagagggggaca
EXON 3  106 bp
tggttggaaccctgcaccctccatgtggctcagcaggtacataccatttgtcacagtgaa
aagccttcactccagcatttttgtttgctatgtattttgctccaggaacattctagaact
ggtagcatgacctctgttcagcgctctctaacccagcattcctttctttggccctgccag
GTGATGTGTCCAATCTAGATCCCAACTTCTCATTTGAAGGCACCAAACTGGATGTGGGGA
ACATTGTGCTGGCATTATACAGCGGCCTCTTTGCCTATGGAGGATG
gtaggttctggaatgtctgggtcccttggtctggggacatacagtccctgacgtgtccag
gaatcccaaatctcccagccatcaaggggcagttaaagggagtggactgcccctcccttt
aactgccccttggcagttaaagagtggcaggtgaccctccagagtcacccacatcccgac
EXON 4  45 bp
gcagggaccccccggaacacgcaggaggctgagctccctcccactccaggtccgctttcc
agcccagcgagcagaccaccggggggcaggctcaccagctgccctgggatgctctctccc
cggtgatttattttccctgatgaggatcatataatttgaacgctgttctctaaattttag
GAATTACTTGAATTTCGTCACAGAGGAAATGATCAACCCCTACAG
gtacgtgcaagaatggatggagccgtcttttttcattattttaatgtgaggcaggaagca
gccacattccactcgaagcctgttggtcggctcaggccagttcacagtcgggccgtgatt
ggggcctctggggccagcaggatgtggggcgggtggcttctggccgtgtgtccttgagca
EXON 5  124 bp
cgctccaggcacagcctcctgccgccagcctgtgttctcttgctgcttcccaccttcccc
gagaagcccagcacagaggctggagctactgcttgcgaggagcccacctggctcctgggc
acagggtttggccttcagcccgggctgcgttgggtgacatgtcgtccctgttctttccag
AAACCTGCCCCTGGCCATCATCATCTCCCTGCCCATCGTGACGCTGGTGTACGTGCTGAC
CAACCTGGCCTACTTCACCACCCTGTCCACCGAGCAGATGCTGTCGTCCGAGGCCGTGGC
CGTG
gtgagccgctacccgccagcttccaccaggggcctgagaggctgtggccagcccgtccct
tccagaccggagtggtgccccacatctctaagcctcccctacgcagagggggccccgcgt
ctctaagcctcccctacccggaggggtggagtggtggtctcccctcacagcgaccgcaga
EXON 6  104 bp
tggaaagccctgtcctgggaagtccccccagaggccagaatccagcctgagaggtcctct
gcagagggctcttgtgagcacagagggcgagggctggcccggtgcagagggctcccagtg
agcacagggagggcgagggccggcccggtggggcccagctcactggttgtgcctgcctag
GACTTCGGGAACTATCACCTGGGCGTCATGTCCTGGATCATCCCCGTCTTCGTGGGCCTG
TCCTGCTTCGGCTCCGTCAATGGGTCCCTGTTCACATCCTCCAG
gtgagcacagcccgacccaccacaggtgagggaggcccaggcctcatggccaggttcaac
atgttccatgtctgtaaaaggtttgtctctgtgatactggggatgcataattgctcaaat
aggccaggcatggtggctcatacctgtaatcccagcactttaggaggccgaggtgagcag
EXON 7  97 bp
agttggttgggggaactgagaggcccacagccagcggctggaggggcctggttcccactg
tggccagagaggcccagacaagccaggcacaggccctgccactccccagcctgcgtgtcc
cctgtccacgtgctgagttgtggggcggtggctgactctgccactcttgtctgtccacag
GCTCTTCTTCGTGGGGTCCCGGGAAGGCCACCTGCCCTCCATCCTCTCCATGATCCACCC
ACAGCTCCTCACCCCCGTGCCGTCCCTCGTGTTCACG
gtaagcctgctgcacggccctgtgccctacatccctgggggttgtccgggggctcccaga
gggaggctgccacagcttgcagctctgtctggggtgtggactgggtgacagctcaaatgt
ggcctcctgccgagctccgctgaatgccagagagcgctggaggggctttagattttattc
EXON 8  150 bp
cttccctcctttcctccttcaagaccttgcatgttgctcagatgaggtttctcctttaaa
acaaaattccctggtgctcagctgggcccagccaggctggacagtccccggtggccacca
cggccgtccacagccctgctcgtgggccccagggctcagccagccgcctctctcttccag
TGTGTGATGACGCTGCTCTACGCCTTCTCCAAGGACATCTTCTCCGTCATCAACTTCTTC
AGCTTCTTCAACTGGCTCTGCGTGGCCCTGGCCATCATCGGCATGATCTGGCTGCGCCAC
AGAAAGCCTGAGCTTGAGCGGCCCATCAAG
gtgagcccggggcctcccgctcacccaggcacccttcacagaggcagggtccgtgggtcc
taaggaccctgagttgggagccagcatcccagctcagcctctggacctgcccctgcctgc
atgcacctgggtcgactaattccggtgatgacttgaccaccagctacgagggtgccaagt
EXON 9  178 bp
tgcagagtcgagggcgggacagcccggtgtgtgaggcagatggagtgcagatcgcatctt
ggtgacctggaagtcagcagccgtgggtgtggagggcccaggagggctgaggaacctcgg
ggcatgggggagggaggctggacaggagagggctcacccaggccctgtcctctgccccag
GTGAACCTGGCCCTGCCTGTGTTCTTCATCCTGGCCTGCCTCTTCCTGATCGCCGTCTCC
TTCTGGAAGACACCCGTGGAGTGTGGCATCGGCTTCACCATCATCCTCAGCGGGCTGCCC
GTCTACTTCTTCGGGGTCTGGTGGAAAAACAAGCCCAAGTGGCTCCTCCAGGGCATCT
gtgagtatctcgctggcccacagcccgtggtaccctctgccctgggcagcgaagggagtt
gagaggcgtcggccgtctccacccacatggggcgaagcgtgttgggtggcaggagggttc
aggtcactgcagtgtccgccagtgacacgcagcccacatggttcagggataagacacaca
EXON 10  3002 bp
ctcgggcacccggcacccacatgcgcaagtacacaagggaaggttccttaaaatcccagc
gctgggcagcggcgctgggtttggtgacagcagggctgggggagccccagctcacgcccc
cgtgtcccacgggtgcctacccagcccccaggctaacacagctgtcttctctcctgacag
TCTCCACGACCGTCCTGTGTCAGAAGCTCATGCAGGTGGTCCCCCAGGAGACATAGCCAG
GAGGCCGAGTGGCTGCCGGAGGAGCATGCGCAGAGGCCAGTTAAAGTAGATCACCTCCTC
GAACCCACTCCGGTTCCCCGCAACCCACAGCTCAGCTGCCCATCCCAGTCCCTCGCCGTC
CCTCCCAGGTCGGGCAGTGGAGGCTGCTGTGAAAACTCTGGTACGAATCTCATCCCTCAA
CTGAGGGCCAGGGACCCAGGTGTGCCTGTGCTCCTGCCCAGGAGCAGCTTTTGGTCTCCT
TGGGCCCTTTTTCCCTTCCCTCCTTTGTTTACTTATATATATATTTTTTTTAAACTTAAA
TTTTGGGTCAACTTGACACCACTAAGATGATTTTTTAAGGAGCTGGGGGAAGGCAGGAGC
CTTCCTTTCTCCTGCCCCAAGGGCCCAGACCCTGGGCAAACAGAGCTACTGAGACTTGGA
ACCTCATTGCTACCACAGACTTGCACTGAAGCCGGACAGCTGCCCAGACACATGGGCTTG
TGACATTCGTGAAAACCAACCCTGTGGGCTTATGTCTCTGCCTTAGGGTTTGCAGAGTGG
AAACTCAGCCGTAGGGTGGCACTGGGAGGGGGTGGGGGATCTGGGCAAGGTGGGTGATTC
CTCCCAGGAGGTGCTTGAGGCCCCGATGGACTCCTGACCATAATCCTAGCCCCGAGACAC
CATCCTGAGCCAGGGAACAGCCCCAGGGTTGGGGGGTGCCGGCATCTCCCCTAGCTCACC
AGGCCTGGCCTCTGGGCAGTGTGGCCTCTTGGCTATTTCTGTGTCCAGTTTTGGAGGCTG
AGTTCTGGTTCATGCAGACAAAGCCCTGTCCTTCAGTCTTCTAGAAACAGAGACAAGAAA
GGCAGACACACCGCGGCCAGGCACCCATGTGGGCGCCCACCCTGGGCTCCACACAGCAGT
GTCCCCTGCCCCAGAGGTCGCAGCTACCCTCAGCCTCCAATGCATTGGCCTCTGTACCGC
CCGGCAGCCCCTTCTGGCCGGTGCTGGGTTCCCACTCCCGGCCTAGGCACCTCCCCGCTC
TCCCTGTCACGCTCATGTCCTGTCCTGGTCCTGATGCCCGTTGTCTAGGAGACAGAGCCA
AGCACTGCTCACGTCTCTGCCGCCTGCGTTTGGAGGCCCCTGGGCTCTCACCCAGTCCCC
ACCCGCCTGCAGAGAGGGAACTAGGGCACCCCTTGTTTCTGTTGTTCCCGTGAATTTTTT
TCGCTATGGGAGGCAGCCGAGGCCTGGCCAATGCGGCCCACTTTCCTGAGCTGTCGCTGC
CTCCATGGCAGCAGCCAGGGACCCCCAGAACAAGAAGACCCCGCAGGATCCCTCCTGAGC
TCGGGGGGCTCTGCCTTCTCAGGCCCCGGGCTTCCCTTCTCCCCAGCCAGAGGTGGAGCC
AAGTGGTCCAGCGTCACTCCAGTGCTCAGCTGTGGCTGGAGGAGCTGGCCTGTGGCACAG
CCCTGAGTGTCCCAAGCCGGGAGCCAACGAAGCCGGACACGGCTTCACTGACCAGCGGCT
GCTCAAGCCGCAAGCTCTCAGCAAGTGCCCAGTGGAGCCTGCCGCCCCCGCCTGGGCACC
GGGACCCCCTCACCATCCAGTGGGCCCGGAGAAACCTGATGAACAGTTTGGGGACTCAGG
ACCAGATGTCCGTCTCTCTTGCTTGAGGAATGAAGACCTTTATTCACCCCTGCCCCGTTG
CTTCCCGCTGCACATGGACAGACTTCACAGCGTCTGCTCATAGGACCTGCATCCTTCCTG
GGGACGAATTCCACTCGTCCAAGGGACAGCCCACGGTCTGGAGGCCGAGGACCACCAGCA
GGCAGGTGGACTGACTGTGTTGGGCAAGACCTCTTCCCTCTGGGCCTGTTCTCTTGGCTG
CAAATAAGGACAGCAGCTGGTGCCCCACCTGCCTGGTGCATTGCTGTGTGAATCCAGGAG
GCAGTGGACATCGTAGGCAGCCACGGCCCCGGGTCCAGGAGAAGTGCTCCCTGGAGGCAC
GCACCACTGCTTCCCACTGGGGCCGGCGGGGCCCACGCACGACGTCAGCCTCTTACCTTC
CCGCCTCGGCTAGGGGTCCTCGGGATGCCGTTCTGTTCCAACCTCCTGCTCTGGGACGTG
GACATGCCTCAAGGATACAGGGAGCCGGCGGCCTCTCGACGGCACGCACTTGCCTGTTGG
CTGCTGCGGCTGTGGGCGAGCATGGGGGCTGCCAGCGTCTGTTGTGGAAAGTAGCTGCTA
GTGAAATGGCTGGGGCCGCTGGGGTCCGTCTTCACACTGCGCAGGTCTCTTCTGGGCGTC
TGAGCTGGGGTGGGAGCTCCTCCGCAGAAGGTTGGTGGGGGGTCCAGTCTGTGATCCTTG
GTGCTGTGTGCCCCACTCCAGCCTGGGGACCCCACTTCAGAAGGTAGGGGCCGTGTCCCG
CGGTGCTGACTGAGGCCTGCTTCCCCCTCCCCCTCCTGCTGTGCTGGAATTCCACAGGGA
CCAGGGCCACCGCAGGGGACTGTCTCAGAAGACTTGATTTTTCCGTCCCTTTTTCTCCAC
ACTCCACTGACAAACGTCCCCAGCGGTTTCCACTTGTGGGCTTCAGGTGTTTTCAAGCAC
AACCCACCACAACAAGCAAGTGCATTTTCAGTCGTTGTGCTTTTTTGTTTTGTGCTAACG
TCTTACTAATTTAAAGATGCTGTCGGCACCATGTTTATTTATTTCCAGTGGTCATGCTCA
GCCTTGCTGCTCTGCGTGGCGCAGGTGCCATGCCTGCTCCCTGTCTGTGTCCCAGCCACG
CAGGGCCATCCACTGTGACGTCGGCCGACCAGGCTGGACACCCTCTGCCGAGTAATGACG
TGTGTGGCTGGGACCTTCTTTATTCTGTGTTAATGGCTAACCTGTTACACTGGGCTGGGT
TGGGTAGGGTGTTCTGGCTTTTTTGTGGGGTTTTTATTTTTAAAGAAACACTCAATCATC
CT
accgctgatgttctgtgttcttttcttctgcgccaggttctgtgtataggaacgttcctg
gccccctcttggccacctcattccttcccaccttcacacattcattcattcattcaccga
cagcccacttaggccgctgggtgggggtgagccatgggcgggttgcacacatgtgagcac