Gene PPL Variant 1
DNA : 54.62 KbNT_010552
mRNA : 6227 bp NM_002705
CDS : 5271 bp NP_002696
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  152 bp
gtccggccaagacccagtgtccccacccccgcgtccaagccccgcccgcgcggtggcccc
tcctcgggaaggtaagcaccaccttctcggggagcggcccgcagagccagtggccggcgg
gcgccccgcccccagcgagtagggacccggagccactgccgcgccgcagtccgggctccc
CGCGCCGCCGCTCGCTCACCTGCGCTCCCGCCCGCCCCTCGGTGCGCGCCCGGCCCGCCA
GCCGCCGCCGCCCGCACCCCGAGCGCCACCATGAACTCGCTCTTCAGGAAGAGAAACAAA
GGCAAATACAGCCCCACTGTGCAGACCCGGAG
gtgaggaggcgcccacagctccgctccgggacgctcttgcccctgtgggcgcacaggacc
tggaagacctcccgggcagtgtaggaatggggggtacgggggtccaggaaccgggaactg
aacccggagtgcgggactctcgggaacgcgggaccgaggccaccctgaagctgggaagcg
EXON 2  100 bp
cttgtctctgtggctttagtgatgttgccctatgggaacagcccaactacctcaaaggct
ctgtgggcagctcctgctcagagcgtggggccggggccagccagaggatggggtgctggt
ggggacatagcccccacccaccaggcaccccgcccatctcccctcggcttctgcccgcag
CATCTCTAACAAGGAGCTCTCGGAGCTGATCGAGCAGCTGCAGAAGAATGCCGACCAGGT
GGAGAAGAACATCGTGGACACAGAGGCCAAGATGCAGAGT
gtgagtgcccccactcccactcccacctgggtgccccgtgctgccagccctgttcaggac
caggatctgtttggaatcggtgattctcacccaggggtgattgtggccccgagggaacat
gcagagacattttggttgtcactgcttggaaggaaggtcctcctggcgtccagttgggga
EXON 3  155 bp
accacgtagcagcaaagagatggaactaccgactgcgctccatatggacaagcctggaag
acgttattcaaagggaaagaaggggagcaccctgctgacccctttcctcccacccctccc
attgccaccgtgcccgctctcggctcctgttcattgtcccctctcttgtgaccctcacag
GACCTGGCTCGGCTGCAGGAGGGTCGGCAGCCTGAGCACCGGGACGTGACCCTGCAGAAG
GTGTTGGACTCTGAGAAGCTGCTCTATGTGCTAGAGGCGGATGCGGCCATTGCCAAGCAC
ATGAAGCACCCACAGGGGGACATGATCGCCGAGGA
gtaggtcccttctgcttcttaccccaggggagccattgggggctatgggccagggcgggg
ggtcctgttcagcatttgggagcccgagtcaggggttatcaagggctaattaggtgccag
gcacgtgccaaaggcttcacatgatcctttcttttttttttttttgagacgtagttttgc
EXON 4  121 bp
aaaaaaaaaaaaaagtgcatgggaggaggggtgagaggatgctgtgattgtctggaaccc
aaggccatatggtcactgtgtccttccaggacactgaggccggggtctgggtggggggcc
cctcctggggtgcaggcagtgccaaccagccccactaagtgggagcctctctcccatcag
TATCCGCCAGCTGAAGGAGCGTGTGACCAACCTGCGCGGGAAACACAAGCAGATCTACAG
GCTGGCGGTGAAGGAAGTGGATCCACAGGTCAACTGGGCGGCACTGGTGGAGGAGAAGCT
G
gtatggcctggacggggccgctggctccagggtttcagctggggagggggctgtgcgtgt
gcagggagagcctacccatgtaatgggcatcccgggtcttaccagggagacagtcgtggt
cctgatggttttccagtgtgcccatgagaagagtgaggctcagagaagtgcagcacgaag
EXON 5  126 bp
gtcagtgctcagcaaacagaacctcagggttgaaggtgtggccagcatctccttgtggct
ctgcagggccccgtgaaaaagagagcaccatcatgcccacccccgaggctcctggggtgg
ccacacgtccccagccctcagcccaccctctccttattgcttctctgccctcctggccag
GACAAGCTGAACAACCAGAGCTTTGGGACTGACCTGCCGCTGGTGGACCACCAAGTGGAG
GAGCATAACATCTTCCACAATGAGGTCAAGGCCATCGGGCCCCACCTGGCCAAGGACGGG
GACAAG
gtggggcgtgtgctggtgtggtggggacccagggatggagggggccgcgcctgcttcctg
gccctgacccatgccctcggctctgtcctcaggagcagaacagcgaactccgggccaagt
accagaaactgctggtgaggagctccctgggggaaaggcctcatggggagaggagaggat
EXON 6  42 bp
gctggtggaccaccaagtggaggagcataacatcttccacaatgaggtcaaggccatcgg
gccccacctggccaaggacggggacaaggtggggcgtgtgctggtgtggtggggacccag
ggatggagggggccgcgcctgcttcctggccctgacccatgccctcggctctgtcctcag
GAGCAGAACAGCGAACTCCGGGCCAAGTACCAGAAACTGCTG
gtgaggagctccctgggggaaaggcctcatggggagaggagaggatgggaagcttggagt
cggggggacaaggatgtattgttttaaaaatgacataggcagctgggcatggtggctcac
gcctagcactttgggaggcagaggcaggaggatcacttgagcccacgagtttgagaccaa
EXON 7  162 bp
caggtgacttgtctaagggggactggcctggacgtggctaagctgggcttgtcctcaggc
cacccatagctgggcttgtcctcaggccagccatagctgggccctgcaggaggtagggaa
ggaagcgagcagtggcagcgggctgaggacgcagccctttccttgccccggccccttcag
GCAGCATCACAGGCCCGGCAGCAGCACCTGAGTTCGCTGCAGGACTACATGCAGCGCTGC
ACCAATGAGCTGTACTGGCTGGACCAGCAGGCCAAGGGCCGCATGCAGTACGACTGGAGT
GACCGCAACCTCGACTACCCCAGCCGCCGGCGCCAGTATGAG
gtgggttctgggggcctggggcatcagggaggaggcagccctggaaggagcacgggaccg
ccaggctgggcactgaggcccctccactgccccccactgcagaatttcatcaaccggaac
ctggaggccaaagaggagagaatcaacaaactgcacagcgagggcgaccagctgctggcg
EXON 8  108 bp
cagcaggccaagggccgcatgcagtacgactggagtgaccgcaacctcgactaccccagc
cgccggcgccagtatgaggtgggttctgggggcctggggcatcagggaggaggcagccct
ggaaggagcacgggaccgccaggctgggcactgaggcccctccactgccccccactgcag
AATTTCATCAACCGGAACCTGGAGGCCAAAGAGGAGAGAATCAACAAACTGCACAGCGAG
GGCGACCAGCTGCTGGCGGCCGAGCACCCCGGGAGGAACTCCATTGAG
gttcatgcaccccgagaccagacacctcccccagggtggcttctggttggccgctgcctg
tgggccgcctggagctcgggcagaccccggagctgggggtcctgcaagctgcatcttgtg
tctgtctgtctctttcttgctgtgtctgactctgcctcctccatttatcctgatccgttg
EXON 9  96 bp
tgacccctctctcctcctcccactcctgagcagaagctggctacccctgtggtagccaca
cccagacagatgccagatgcctccctcccccgccatgccccagcccaatatcccagcagt
ccctcccttggtgtctgcagtacctgcccagtggtgaccggccccttctcttcctggcag
GCGCACATGGAGGCTGTGCACGCAGACTGGAAGGAGTACCTGAACCTGCTCATCTGCGAG
GAGAGCCACCTCAAGTACATGGAGGACTACCACCAG
gtacttacctttcctgggagtccccccagcaccgggggtgctactctctgagagcgctca
gtgcctacctggctcatgtgtggcctcgtgctccttggtccaggagccttgcggggcagc
catcccaggcccccagcacccatgcttctgatggcgtgtgcagacatgtcccaagcttgc
EXON 10  123 bp
ctcagggagggtggggctgtctccacgcagaggagcctcaggctcagcacagggtcccat
gctggactccaggtgaaccggaggcccagccccgcctgagggatgagcttgaagcctccg
acagaagcccaggtgcttctagtggtttcctggctgtaacagagccaccttctcccctag
TTTCACGAAGACGTGAAGGACGCTCAGGAGCTGCTGCGCAAGGTGGACTCGGACCTGAAC
CAGAAGTATGGCCCTGACTTCAAGGACCGGTACCAGATTGAGCTGCTGCTGCGGGAGCTG
GAT
gtgagcgatggcccaggacccctgctggcccggggggcgggggacccctctacaccatgc
ctgccctcagccctgtacaggcccctccacagcaccccacctgctgaatccagcccctgc
tctgcgtcctcccaccagggggaaggctgttggtctcacctgggcccctgaccccgttct
EXON 11  147 bp
gatggcccaggacccctgctggcccggggggcgggggacccctctacaccatgcctgccc
tcagccctgtacaggcccctccacagcaccccacctgctgaatccagcccctgctctgcg
tcctcccaccagggggaaggctgttggtctcacctgggcccctgaccccgttctctccag
GACCAGGAGAAGGTGCTGGACAAGTATGAGGACGTGGTGCAGGGGCTGCAGAAGCGAGGC
CAGCAGGTGGTGCCCCTCAAGTACCGCCGGGAGACTCCGCTCAAGCCCATCCCCGTGGAG
GCACTCTGTGACTTTGAGGGGGAGCAG
gtgcgtggggccagctcctctgttcacatcactacaaagtttttggggtaacatggttgg
atcccgggcctcaggcgccgttctcaggagcctgtgcctgtctccgtggttggtgtcact
ctgccaacccttcccctggtgcaggccaactggcacccctatgccgcccccacctcggct
EXON 12  152 bp
tgctgggccggcagcctcaacacatgtgcttctcctgcatgcccctccccactctacggg
gagggtccaagtgatgagccggggctccccaggtccaagagtcgggggctgagatggcaa
ccgggctcccaggccctcaggccctgccgggatcctgactgtccagcctgcccccgccag
GGCCTGATCTCGCGGGGCTACAGCTACACCCTGCAGAAGAACAACGGGGAGAGCTGGGAG
CTCATGGACAGCGCTGGGAACAAGCTGATTGCTCCGGCCGTGTGTTTTGTGATCCCCCCC
ACAGACCCTGAGGCCCTGGCTCTGGCTGACAG
gtacaagggcaaaggcgggagtctgcatggaccagtcccacccccagggcttctcaggcc
ccattcatagccccggggatttggactcagcctgtggggagcgcggggtcgctgacactc
tccatctgcacccccttggaagttcatgcaggagaggggcagattgtgggccagctgact
EXON 13  98 bp
gaagagctctgagcccaggagcacagaaaggccagtgccacagtgagcacttgctgtccg
catctaaggagctgtcaggctcctctggggtgtctgcccagccagagtccgcagtcccgc
ctctgtgggtgcagggggtggtgggctgcccaggttcccagctcatttctgtcctcacag
CCTGGGCAGCCAGTACCGGAGCGTGCGGCAGAAGGCAGCTGGGAGCAAACGCACGCTGCA
GCAGCGGTATGAGGTGCTGAAGACCGAGAATCCCGGAG
gtgggtgccagggccactcgcctgaggctctgggggtaccggggaggaggggctggacca
gggtctgtgctgtggatgagacggcggggggctggctgcctaggtccatccctgggcctc
acacccctggcccgttgtcacacctgcctgtgtcctccctccctccacagatgcctctga
EXON 14  158 bp
aatcccggaggtgggtgccagggccactcgcctgaggctctgggggtaccggggaggagg
ggctggaccagggtctgtgctgtggatgagacggcggggggctggctgcctaggtccatc
cctgggcctcacacccctggcccgttgtcacacctgcctgtgtcctccctccctccacag
ATGCCTCTGACCTACAGGGGCGGCAGCTGCTGGCTGGCTTGGACAAGGTGGCCAGCGACC
TGGACCGGCAGGAGAAGGCCATCACAGGGATCCTGCGGCCACCACTGGAGCAAGGCCGGG
CTGTGCAGGACAGTGCCGAGCGGGCCAAGGACCTCAAG
gtacctgcgggtcaggagcacaggtggggccgggggagccctgcactggccccctggggc
ccctatttgaggtcttttccccatggagtcttgggatattcactgcagctgtctgtcagg
gacagcctgctgcatgtaaaagggtcccaagtcatggaggtggcagggctgctgtcatta
EXON 15  179 bp
cgtgaaaaatacagccctcaggctggggtccagatgccgggtcagagccccagaatgtgc
caggcctctccagctgcttccactgtgcctgatgtgggaatctgtgctcaccctgggcac
atcctcaggggaaggggctgcctggctgtgtccaaaactgaggggccctggttcccacag
AACATCACCAACGAGCTACTGCGGATTGAACCTGAGAAGACGCGGAGCACGGCTGAGGGC
GAAGCCTTCATCCAGGCCCTCCCAGGCAGTGGCACCACACCCCTGCTGAGGACCCGGGTG
GAGGACACCAACCGGAAATACGAGCACCTCCTGCAGCTGCTGGACTTGGCCCAGGAGAA
gtgggtggcagacaggcagcatggaggttggggtggggtcagggggccaggtgggcatcc
cccgacgcctgattggtgctctcagggttgatgtggccaaccgcctggagaagagcctgc
agcagagctgggagttgctggccacacacgagaaccatctgaatcaggatgacacagtgc
EXON 16  139 bp
ggcagtggcaccacacccctgctgaggacccgggtggaggacaccaaccggaaatacgag
cacctcctgcagctgctggacttggcccaggagaagtgggtggcagacaggcagcatgga
ggttggggtggggtcagggggccaggtgggcatcccccgacgcctgattggtgctctcag
GGTTGATGTGGCCAACCGCCTGGAGAAGAGCCTGCAGCAGAGCTGGGAGTTGCTGGCCAC
ACACGAGAACCATCTGAATCAGGATGACACAGTGCCTGAGAGCAGCCGTGTCCTGGACAG
CAAGGGGCAGGAGCTGGCG
gtgagtctagggcccaagtcctgggagtccttctctgagcaggtgagagcatctggcaca
tccacccgcccgtctggatagatgaggacaccagcatccagtctccccaggtttggaatg
cccaaattgggaactgcaaatggaggcccacagcacaaatccaagctattcacgggatct
EXON 17  194 bp
aaaacagaagatggcagaagtgacccaggtttgggatgtacagagcaaggctccggtcct
tcctacctgtggccttgcccaccctcctacagtcagtggcccaggggcttcagtgggtgt
catcgcctggctctgggagctctggccgtagcaccgccgtctcctcctctgccccgccag
GCCATGGCCTGTGAGTTACAGGCCCAGAAGTCCCTCCTGGGTGAGGTGGAGCAGAACTTG
CAGGCGGCCAAGCAGTGCTCGAGCACACTGGCCAGCCGCTTCCAGGAGCACTGTCCGGAC
CTGGAGCGCCAGGAGGCCGAGGTGCACAAGCTGGGCCAGCGTTTCAACAACCTGCGCCAG
CAGGTGGAACGCAG
gtgagggtgcggtgggtggtggccatttttgttttctgagaatgcgatctaattccctct
aagcaatgctttagccgtgtcccacagattttgctgtttttctttttggtgagttcgtca
gattctctgacggccctgtggtctctcttttgagtcatgcttacctgggtcctgtaatcc
EXON 18  151 bp
acccacctggttctccacagtccaacctgacgttccctaatgaccacccaccctgtgtgg
gagatacttggggtatttctggttgttacatttggttgtttcccactttaaaaaaaaaaa
tgagggctcggtgaggcatctgtttgctgtggctgaggcctgaacgctttgccttgacag
GGCGCAGAGCCTACAGAGCGCCAAGGCAGCCTACGAGCACTTCCACCGCGGCCATGACCA
CGTGCTGCAGTTCCTAGTCAGCATCCCCAGTTACGAGCCCCAGGAGACAGACAGCCTCAG
CCAGATGGAGACCAAGCTGAAGAACCAGAAG
gtgagatggccgtttccgcagccccaggcacacactggcaagggagggtcagaggtcaac
aagcccctttctggggagccaagcctttgggaggtggagcagggcagaggcctgccacag
ctgtgtcctccctgggcctcagctcaagctcccaacacccaaccctctgagaacaagaac
EXON 19  84 bp
caacaacaacaaaaaaactgccttttgcaatgaataaaaatgtatacaagggagccattc
atcatactttgtgctagagaagaataaattcagattctgagatttccagctactgcatcc
atggttgcttttttaaattttttttctggttagttttgatttttaaactctgtcttacag
AACCTGCTAGATGAGATAGCAAGTAGGGAGCAGGAAGTACAGAAGATCTGTGCCAATTCC
CAGCAGTACCAGCAAGCTGTAAAG
gtgagccgggaaacttccgcccaaagcacaaacagcaggggtcttattccaccgtgccct
ggtcagagaagcagcaagcaccggccctggcacatgggggtggagctggccatccgaggc
actgccggctgctgtgcaaactggcacaggcttttgggaaaacagcatggtactagacat
EXON 20  117 bp
gtaattctcaaaacctcctggaaatcactgcagggtgcagctgtgaggaagacccacgca
gattataaaaccagcacatggcacagggcaggtctgggtcagcctgaaggggtacaggaa
catgtctgtctcttctcagctgttttaatctcccctctgccatgtctctccctcatgcag
GACTATGAGTTAGAAGCAGAAAAACTAAGGTCTCTTCTCGACTTGGAGAATGGAAGGAGA
AGCCACGTGAGCAAGAGAGCCAGGCTCCAATCTCCTGCCACCAAAGTGAAGGAAGAG
gtgagttccatgggccaggcggcctcgggactgaggtggaggccaagctgccctgctccc
cagggagcatggtgtcacacgctggcctcagagatgcacacacaacagggaagccactga
gagccctcctgcatgcaaacaggtttggtaagagatgaggaacttgttctagggcagtga
EXON 21  93 bp
atccatttttctctccaccggtgaggctacagtctaactccaggcaggagtgggcaagag
ctatgcctctacccccaaattccacacttctcaagaaccacgtccacgctgtctagctct
ctgttgcttaccctgttgacacctgtttgttgaccgctctcctaatcctcttctctgcag
GAAGCAGCACTTGCCGCCAAGTTCACTGAAGTTTATGCCATCAACAGACAGAGGCTGCAG
AATCTGGAGTTTGCTCTGAATCTCCTCAGACAG
gtaactgatcttagtaagaaattctacttcaggctgttctaacaggtgacaaatacagac
tctgtcttagagaaatggtttgtgaattgatggaagtgtccccttgctaacgtttctggg
cagggccaatgcaaagactggcccgagccaatgcttctactgacatgagaacttattcaa
EXON 22  3530 bp
aaccccaaactagttgtttgatcctttttgaaagtaaccctagaactctacaactaacat
gaactggcactgagggagtcccttggggaccacaggacagccactctgaccaggtgggga
caggccctacatgtgctgccagagcctggctttaaccttgtcttgtcttctccatcacag
CAGCCGGAAGTAGAAGTGACCCATGAGACCCTGCAAAGGAATAGGCCGGACTCTGGAGTG
GAGGAGGCGTGGAAGATCAGGAAGGAACTGGATGAGGAGACTGAGCGGAGGCGGCAGCTG
GAGAACGAGGTCAAGAGCACCCAGGAAGAAATCTGGACCTTGAGGAATCAGGGGCCTCAG
GAATCGGTGGTGAGGAAGGAGGTGCTCAAGAAGGTGCCGGATCCCGTGCTGGAGGAGAGC
TTCCAGCAGCTGCAGCGGACGCTGGCAGAGGAGCAGCACAAGAACCAGCTGCTGCAGGAG
GAGCTGGAGGCACTGCAGCTGCAGCTGCGTGCCCTGGAGCAGGAGACCAGAGACGGGGGG
CAGGAGTACGTGGTCAAGGAGGTCCTGCGCATCGAGCCTGACAGGGCCCAGGCGGATGAG
GTCTTGCAGCTGCGGGAGGAGCTGGAGGCACTGAGGCGGCAGAAGGGCGCCCGGGAGGCA
GAGGTGCTCCTCCTGCAGCAGCGTGTGGCCGCCCTGGCTGAAGAGAAGAGCCGGGCGCAG
GAGAAGGTCACAGAGAAAGAGGTGGTGAAACTGCAGAATGACCCCCAGCTGGAGGCAGAG
TACCAGCAGCTGCAGGAGGACCACCAGCGCCAGGACCAGCTCAGGGAGAAGCAGGAGGAG
GAGCTGAGCTTCCTCCAGGACAAGCTCAAGAGGCTAGAGAAGGAGCGGGCCATGGCCGAG
GGCAAGATCACCGTCAAGGAGGTGCTCAAGGTGGAGAAGGACGCGGCCACCGAGAGGGAG
GTCAGCGATCTCACCCGCCAATATGAGGACGAGGCTGCCAAGGCTCGCGCTAGCCAGAGG
GAGAAGACGGAGCTGCTCCGAAAGATATGGGCCTTGGAGGAGGAGAACGCCAAAGTGGTG
GTGCAGGAGAAGGTGCGGGAGATCGTGCGGCCAGACCCCAAGGCGGAAAGTGAAGTGGCG
AACCTCCGCCTGGAGCTTGTGGAGCAGGAGCGAAAGTACCGGGGTGCCGAGGAGCAGCTC
CGGAGCTACCAGAGTGAGCTGGAGGCCCTCAGGAGGCGAGGCCCCCAGGTGGAAGTCAAA
GAGGTGACTAAGGAAGTCATTAAGTACAAGACTGACCCTGAGATGGAGAAGGAGCTTCAG
CGGCTCAGGGAGGAGATCGTGGACAAGACCAGACTGATCGAAAGGTGTGATTTAGAGATC
TACCAGCTGAAAAAGGAAATCCAGGCCCTGAAAGACACCAAACCCCAGGTCCAGACCAAA
GAGGTGGTCCAGGAGATCCTCCAATTCCAAGAAGACCCTCAAACCAAGGAGGAGGTGGCG
TCTCTGAGGGCAAAGCTCTCAGAGGAGCAGAAGAAACAAGTGGATCTGGAGAGGGAAAGA
GCTTCCCAGGAAGAGCAGATCGCCCGGAAAGAGGAGGAGCTCTCGCGGGTGAAGGAAAGG
GTGGTGCAGCAGGAGGTGGTCAGGTATGAGGAGGAGCCAGGCCTGCGGGCCGAGGCGAGC
GCCTTTGCCGAGAGCATCGATGTGGAGCTGCGGCAGATTGACAAGCTGCGGGCAGAGCTG
CGGCGGCTGCAGCGCCGGCGCACCGAGCTTGAGCGGCAGCTGGAGGAGCTAGAGCGCGAG
CGGCAGGCCCGCAGGGAGGCCGAGCGCGAGGTACAGCGGTTGCAGCAGCGGCTGGCAGCG
CTGGAGCAGGAAGAAGCTGAGGCCCGTGAGAAGGTAACCCATACGCAGAAGGTGGTGCTG
CAGCAGGACCCGCAGCAGGCGCGAGAGCATGCCCTGCTCCGACTCCAGCTGGAAGAAGAG
CAGCACCGGCGGCAGCTCCTGGAGGGGGAGCTCGAGACCCTCCGGAGGAAACTGGCTGCA
CTGGAGAAGGCGGAGGTCAAGGAGAAGGTGGTGCTCTCCGAGAGTGTCCAGGTGGAGAAG
GGCGACACCGAGCAAGAGATCCAGAGGCTCAAGAGCAGCCTGGAGGAGGAGAGCCGCAGC
AAGCGCGAGCTGGACGTCGAGGTGAGCCGGCTGGAAGCCAGGCTTTCGGAGCTGGAATTC
CATAACTCCAAGTCATCCAAGGAACTAGACTTTCTGAGGGAAGAGAACCACAAATTACAG
CTGGAGAGGCAAAACCTGCAGCTGGAGACCCGAAGGCTCCAATCGGAAATCAACATGGCA
GCGACGGAAACACGAGACCTGCGGAACATGACCGTGGCGGACTCTGGGACCAACCATGAC
TCCAGACTGTGGTCCCTGGAGAGGGAACTGGATGACCTCAAGAGGCTCTCCAAGGACAAA
GACCTCGAGATCGACGAGCTGCAGAAGCGCCTGGGCTCCGTGGCCGTCAAGCGGGAGCAG
CGGGAGAACCACCTGCGGCGCTCCATCGTAGTCATCCACCCTGACACAGGCCGCGAGCTG
TCCCCGGAGGAAGCCCACCGTGCCGGGCTCATTGACTGGAACATGTTCGTGAAACTCAGA
AGCCAGGAGTGCGACTGGGAGGAGATCTCAGTGAAGGGTCCCAATGGGGAGTCCTCAGTG
ATACACGACAGGAAGTCTGGCAAGAAGTTCTCCATCGAAGAGGCCCTGCAGAGTGGCAGG
CTGACCCCTGCTCAGTATGACCGCTATGTCAACAAGGATATGTCCATCCAGGAGCTGGCG
GTCTTGGTATCTGGGCAGAAGTAGGCACAGCTCTTGCAACTCTTCGTAACGGCAGACGCT
GGCCCTCTCCTACGACGCAGTGACCTCCTTGGTGTCGTCCTCTCCCTTGCCCTGGTGCAG
GCCAAGCATTTTATACATACCCTCGCTGCCAGGCTGCTCAGAGTCCCGCCCACATATGAG
ACAGGCACTGGCTGAAGACAGGCAACTCTCGTCCCAACCATCATTCACCCTGAGTGACGT
ACTTCATCCTCCAATGACTGGACAACTGCGATGCCTTTTCCTCCCTTTTCCTGTACACTC
CCAGCAACAAACTCCTCATGATAACTGCACACAATCTGAAAACCACTGAAGGACAAGCCA
ACCACAGCAGCCAAGCCCACTCCTTGCAGCATGGGTACTGGTGGCACACCAGACAGTGAC
ACTGCCCCACAAAGGCCTGGGCCCGTGGGGGCTGCTGCCTGGCATGACATCTCTCCAGAT
TTCTGGCTTAAAACCAACTTTCCATCCGAGAAGCCTCCTCAGTAGTTACTCTGCTCATGA
GACAGATCTGGGCTCCAAGCCAGGAAAGGTGAACAGAAACCACAAGTGTCCAGCCCTCGG
TGCTGGAGTGGACGTTAATTGTCAGCCACCAGACTGTCCCGGCACCTACAGAGAATGTTT
CACAGTTCTGGCATTTAAATCCTTTGATAGTGGATTGTGCTGCTGTTAGCCTTAGTTTCA
GTGCTTTACAAGTCTCGCTTATTATCTCACTGGTATTTAGGTATACAAAACAGTTGATTA
TTCACCACGCCAATATCTGGGTCTCTGTATCTCATGTAGAACATAAGAAAATGGGAACTA
ATAGGGAAATTTATTTATAGCATGAAAATAAACCTGGTGGCTGGAGTCTG
cttgtacggtccacatgtttcttcttttgcatgcaaggcttactcccccgcccccccccc
ttggctttcagccaaaatggatattccatctgtaacagctcctacaggaagaactactta
cttccacatggtagaaagaaaagagtgagaaaaaatgttttggaaaccttgaaacaattt