Gene POLR2C Variant 2
DNA : 9.34 KbNT_010498
mRNA : 1628 bp NM_002694
CDS : 828 bp NP_002685
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  144 bp
ttaagtgaaggacgtatgcgtgttttgccaaactaccctccgagatagctgaatctggta
cattttaaagcaggaggccgcagaagacgctcggcagttctggcctccgagcagcaggcg
gcgctgtgagtcgtctttgcggaagccgcggaggcctcgctgactgacttccggtgttgg
CGGTGGCGCCGCGCAGTCACCGCGGAGCAGACGCGGAGGCTGGTGGCCCCTGGGCGAGAT
GCCGTACGCCAACCAGCCTACCGTGCGGATCACGGAGCTCACTGACGAGAATGTCAAGTT
CATCATCGAGAACACCGACCTGGC
gtaaggctaccgagggaagaggctggcggctctggggcgccgggaggcccaagccggggc
cccggggcagggggcgggggtgtagtggggtggggtgggggcgatgtccttccagagctg
cccccctgcaccagggctttagctttgggagcctgcggcgcgggcccagcctgtcgaggc
EXON 2  50 bp
gccgggaggcccaagccggggccccggggcagggggcgggggtgtagtggggtggggtgg
gggcgatgtccttccagagctgcccccctgcaccagggctttagctttgggagcctgcgg
cgcgggcccagcctgtcgaggctgcagcgccttcacgccccttggcttttgatctttcag
GGTGGCCAATTCGATTCGGAGGGTCTTCATCGCTGAGGTTCCCATAATAG
gtaagcgactccccttcctcgttcccgcgcccacgggttcctgccccgctctccacccac
acactctttggggctccttccagtccttggttcgggctgagggtggtagtgctgagaaaa
gtgcattgctggagacttgaccataccctgtgcccttggctcagtggccgcctccctggc
EXON 3  69 bp
ggtgtggtgtgtgtgggtcttattaaaatgcaagtacctgggccccactctaatgctgtg
gaatcagcccagcaatctgcagtttagtgtcaggtgattcctaaatcttgagaaccactg
cattaagtctgtaggtaaatttgatggctaaactccatgtctgcttctttcattttttag
CCATTGACTGGGTTCAGATTGATGCCAATTCCTCAGTTCTTCATGATGAATTCATTGCTC
ACAGGCTTG
gtgagtactccttttactaggaggttaaagggagggtattgtgcctagtgtcaggagggg
gcctccttccagcctcacccccagaaggcttctgggttctcattttggcttggctgtttg
gttttctttaaagtgcttttctgttttttacaggattaattcccctcattagtgatgaca
EXON 4  53 bp
atgatgaattcattgctcacaggcttggtgagtactccttttactaggaggttaaaggga
gggtattgtgcctagtgtcaggagggggcctccttccagcctcacccccagaaggcttct
gggttctcattttggcttggctgtttggttttctttaaagtgcttttctgttttttacag
GATTAATTCCCCTCATTAGTGATGACATTGTGGACAAGCTGCAGTACTCTCGG
gtatgttgtgtgattgggtggaatgtgaggtttggtggggaggctttggttctcaaaggg
atttttcctgacatttggcatccagcttgaatactgttgtagttctggaacaacaacgtg
gagatgttgtctagagcctgggcaggccttggtcctgcgttctgatggggcttcagattg
EXON 5  129 bp
gtccatgagaatggtataccagattgtcacagcccacaagaacctggatactgatgaacc
cctttttacaggtgaagaaacttaaggaactgggcattagatgcaggaagccaagacaag
gagccaaggcaggagttgccatctccctttgactcattcctgcttcccttcctgccttag
GACTGCACATGTGAGGAGTTCTGCCCCGAGTGCTCGGTGGAGTTCACCCTCGATGTGCGG
TGCAATGAAGACCAGACGCGACATGTCACGTCTCGAGACCTCATCTCCAACAGCCCCCGG
GTCATTCCG
gtcagtgcgggagagcatcctcttttccctgggatcttttctcttctctggctggctcca
agtgggccagactggggttgatccttagaaaatgttggctttccctgttaccctctgcct
taatctgatccctagaagtgctaattctggattcctcttgggcatcgttagcatcgttgg
EXON 6  52 bp
ctgaggctaccaccacaccctgaagtgggggttggagtcctgggggcatctgtgccacca
cctcgtcaggtgttcgttccctggttgacagattgcagtctagaggtgctgggatatgga
tgccagaggaggtgactggggaggtgagcagctaatgaatgcctggtggactccctacag
GTGACATCCCGGAACCGAGATAATGACCCCAATGACTACGTGGAGCAGGATG
gtaagtcttcctgacctgtcaccgtgtgggccagcgggaaggagggaccagacacagcct
ctcgtgctgcctggtctcctcgaaaattggctttagaccgtttttccagatgtgtgtggt
cttgcagtggcactccaagtcagaatttggagaagcatgtctctcctggcccttgactga
EXON 7  169 bp
caccgtgtgggccagcgggaaggagggaccagacacagcctctcgtgctgcctggtctcc
tcgaaaattggctttagaccgtttttccagatgtgtgtggtcttgcagtggcactccaag
tcagaatttggagaagcatgtctctcctggcccttgactgacttgtgcctctccctgcag
ACATCCTCATCGTCAAGTTGAGAAAGGGCCAGGAGCTGAGACTTCGAGCCTATGCCAAAA
AGGGCTTTGGCAAGGAGCATGCCAAGTGGAACCCTACTGCAGGGGTGGCTTTTGAATACG
ATCCAGACAATGCCCTGAGGCACACAGTGTACCCCAAGCCCGAGGAATG
gtatgttccccttaggagtgatggcaggcatttggggtgggtgtggcatagaaatggctg
ttgttgactgagatgtggcaggctctctaggaacttgggtgccccaaaaggagcagtggc
aaccttgtgctgacctgtgtttgacctcaggccaaagagtgagtactcggagctggatga
EXON 8  75 bp
gcacacagtgtaccccaagcccgaggaatggtatgttccccttaggagtgatggcaggca
tttggggtgggtgtggcatagaaatggctgttgttgactgagatgtggcaggctctctag
gaacttgggtgccccaaaaggagcagtggcaaccttgtgctgacctgtgtttgacctcag
GCCAAAGAGTGAGTACTCGGAGCTGGATGAGGATGAGTCGCAGGCTCCCTATGACCCCAA
CGGCAAGCCAGAAAG
gtaagagcctggttggacatgggaaggtgaagtgtggaagaagggatggttttggttcag
gccgtgagttaggcattccctctcccccacctcgcagttctcataagctgaggaggggct
gctgactgctaaactagacctgtggtatgtgcacatcccaggggcaggtcgtcagcccct
EXON 9  656 bp
aaagtgtgttgaaactaccctatgtaagaggttttacatgaaaggaagttagccctggcc
caaggtcaagttccatgtgggaacagagccaagacccggaaggaggaagggttgtccatg
gccagagctcgggtcggccagcctgcctcgcagtgcactcactggactcttgcctcctag
GTTTTACTACAATGTGGAGTCCTGTGGCTCTCTGCGTCCTGAAACCATTGTCCTGTCAGC
CCTCTCAGGATTGAAGAAGAAACTGAGTGATTTACAAACTCAATTAAGCCACGAGATCCA
GAGTGATGTGCTAACCATAAATTAACTGCAGCTTGCCTGCTTCAGCAAAAACGGAGATTC
AGGCCAGCAGCTGGATATGGGGGTCTCTCTTCAGACTCTTCTCGTTTCTGAGAATCTAGT
CTACTGTTGGTTGAGCTTCTTGGCAGGACATCAGTACCAACTAGAAGTGGGTCATAGATA
GATTACCAGGGATGCAGTGGTGTTTAGGCAGGATAGGTCTTTACTGGCCCTGACTGCTGT
TAATAATTGGCAGCAGTGCTCCCCAGATCCCAGAAGGTCCCTGCTGGAGTGTTTCCAGTG
CACCTGTAGGGAACCAACTAGACTTCTCTCCTGGTTAGTCCAGCTCTTTACTCTAAACCC
TTTCTGTCCAAAATGAGTCATTTTCAGTTGTACCTTAGATGTCTGGTGTTGAGGATCAAG
TGCCATAGCCTTTATTCAGGGGGCCTATAAACCCTTCCAGTTCTTGCCCCAGGGCTGGCC
TGCTAGCGCTTCAAATTCCCAGGTGTCCCTAATTTGAGAAGTAACCTTTTGGAATA
gcattagaccctggctgtcccctccccaccaaataaacatgatatttcattctctgtcca
gcagtcatgaaccccttcacctccaatgacctgatcatttagtttggtgggggtgggggt
gggggtgggggtggaagcagccgcaggagcaagggcccctcccacatacacaggaggagt
EXON 10  231 bp
ccaggtgtccctaatttgagaagtaaccttttggaatagcattagaccctggctgtcccc
tccccaccaaataaacatgatatttcattctctgtccagcagtcatgaaccccttcacct
ccaatgacctgatcatttagtttggtgggggtgggggtgggggtgggggtggaagcagcc
GCAGGAGCAAGGGCCCCTCCCACATACACAGGAGGAGTATTTCATTTCTCCTTAATGAAG
GCTCTGGCCCTAACCCCTCAGCACTGTCTCCAGATAGGAACATGCACAAAGCAGTTAATT
AGGCAGCCTGGAGAAAACCAGAGATCCAGTACAGAAAGGAAAGGATATTTATTGATTAAC
AGAAGTTGTCTTTTTAAAAGTGTTTATTTTTGGCAATAAAGAGCACAACAT
aatctccttcatgcgtcatcgtgccacttagctgagccagccagctctgcctccctcccc
aaagacctttggaccccagttcccctctacaggctagctcatccctctgggtggtcattc
cccgggtcacgttgagagcgaggctgactgcaccacctccctagctcaagggctcctttg