Gene MSLN Variant 1
DNA : 7.77 KbNT_037887
mRNA : 2059 bp NM_013404
CDS : 1887 bp NP_037536
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  79 bp
ccgggcgttaggggtaaagctccctacccaactgcgcagaaggcctcagaggcctggggg
ctgggcttcccctttcacatcgccctttagaggcccacgtgtgggcattggcccgcgatc
tgaaaggggctgtcctgttcctcatgggcgctgccagcgccacgcactcctctttctgcc
TGGCCGGCCACTCCCGTCTGCTGTGACGCGCGGACAGAGAGCTACCGGTGGACCCACGGT
GCCTCCCTCCCTGGGATCT
gtaagtaacaacctttgagctcttcctgttgtggtgtggatggaatctgcaccttccatc
tggagaactggggccgccccaggccgggcttccagcaccagagcgatggtcaggcttcag
ctggacgcagatttcaccccgcagggcacacgcagacccatttgtttggaagcggcagtc
EXON 2  94 bp
agtccaggggacagagggctcagtggctggagggcagggccagggtgcggacacaagctg
caggtaccacagaagtttgctctgggagcccctcctgggcccatgtggccccaggctggc
ccaggacagaggcgtggggtgggagcagggggtcccatcctgagtcactgccctccacag
ACACAGACCATGGCCTTGCCAACGGCTCGACCCCTGTTGGGGTCCTGTGGGACCCCCGCC
CTCGGCAGCCTCCTGTTCCTGCTCTTCAGCCTCG
gtgcgtacttgatggggctgctggtgaggtggggacggcccaggggccttgggggccagg
cccccagcaaggctttgcctgcccctgccttctccctggagtgcctgtggtggccacgtc
tcagcagcagtctctgcccccagaggtgactggagctggagatccagccagggagtgatg
EXON 3  40 bp
cccctgtgcctgggggactgtgatgtcacggggtacatgggcctgagccactggcttctc
tttggggtgtgcacagggctggctgtgggggcggccaggctctgcctccttcctcccctg
ggtcagggcacagcccagaggcccgccccctcccccaagctgtcccctctgcccctttag
GATGGGTGCAGCCCTCGAGGACCCTGGCTGGAGAGACAGG
gcaggtaaggtcccctctggggaaacaggggagggtcttcaggtcccaggtgggggtgcc
atgctgtgttctctctgtcacgtatccacggtgcttgccagtttccacggtccttgcttg
caaaggggcacctggacctgcatgtgactggcctgggagcagccaggtccagggagcggc
EXON 4  121 bp
tgacacccctcaggtgatggcaactcccggcccttgagggcgtcacctggtcttgggggg
aggtctgcagggagcaccagggtcctttggggagaggtggggctgtggggcttggggagc
actgggtggacattgcaggggaggggcgatcgtgggtgcccagcccgacccttcctgcag
CCTCTCCCCTCGCCAACTCCTTGGCTTCCCGTGTGCGGAGGTGTCCGGCCTGAGCACGGA
GCGTGTCCGGGAGCTGGCTGTGGCCTTGGCACAGAAGAATGTCAAGCTCTCAACAGAGCA
G
gtcagtctcagttgggctgaggcaggtgggcacagctggggctgaggaattcacaggcag
ctctgcagtgcccaccttgccaccacggtcccctctgtccctgctgccatctctccccgg
ccagttcttcccagagttcctctggccacccaagctgaccactggggtgcctgtccacgt
EXON 5  80 bp
agccaggcacgggagcccccatcccccagggcagcgctgcaggcggccagagatccactt
ccacagattctcgtggccagggcaggggtgtgttgtggtgggcagactggccaggcgacc
ctggcccaccatgtgagtggcggctcgaaacgctctgtgctggactccctgcccctgcag
CTGCGCTGTCTGGCTCACCGGCTCTCTGAGCCCCCCGAGGACCTGGACGCCCTCCCATTG
GACCTGCTGCTATTCCTCAA
gtaggccctgccccctgaacccacccccccggcttttgccgccagccctcagcccccaac
cccctgccccttgcctcggatcccaggccacagcagagatgtggaggccggccgggctgc
ctctcagggtggggacgggtgtgatcagtgcggcctgtccccagcaccctctcttcacag
EXON 6  130 bp
gtaggccctgccccctgaacccacccccccggcttttgccgccagccctcagcccccaac
cccctgccccttgcctcggatcccaggccacagcagagatgtggaggccggccgggctgc
ctctcagggtggggacgggtgtgatcagtgcggcctgtccccagcaccctctcttcacag
CCCAGATGCGTTCTCGGGGCCCCAGGCCTGCACCCGTTTCTTCTCCCGCATCACGAAGGC
CAATGTGGACCTGCTCCCGAGGGGGGCTCCCGAGCGACAGCGGCTGCTGCCTGCGGCTCT
GGCCTGCTGG
gtaggggctggggccagcgcggggcggagagggctcggcagttccaaaagcgctgaggcc
agcctctctgcagggtgtgcgggggtctctgctgagcgaggctgatgtgcgggctctggg
aggcctggcttgcgacctgcctgggcgctttgtggccgagtcggccgaagtgctgctacc
EXON 7  194 bp
aggcctgcacccgtttcttctcccgcatcacgaaggccaatgtggacctgctcccgaggg
gggctcccgagcgacagcggctgctgcctgcggctctggcctgctgggtaggggctgggg
ccagcgcggggcggagagggctcggcagttccaaaagcgctgaggccagcctctctgcag
GGTGTGCGGGGGTCTCTGCTGAGCGAGGCTGATGTGCGGGCTCTGGGAGGCCTGGCTTGC
GACCTGCCTGGGCGCTTTGTGGCCGAGTCGGCCGAAGTGCTGCTACCCCGGCTGGTGAGC
TGCCCGGGACCCCTGGACCAGGACCAGCAGGAGGCAGCCAGGGCGGCTCTGCAGGGCGGG
GGACCCCCCTACGG
gtaagtgaaggtgtctggaacctcgaaggctcacctggcggcgtggtatcagcagcgtga
ggacacttgcggccatgcctcaaggcccagggtcagtcacccccgccaccacccctgcca
atgcccccagcgtcccctccacagccagggggtacggcctggcctcttccctctctgggg
EXON 8  91 bp
tggtatcagcagcgtgaggacacttgcggccatgcctcaaggcccagggtcagtcacccc
cgccaccacccctgccaatgcccccagcgtcccctccacagccagggggtacggcctggc
ctcttccctctctggggctgcacgtggggggtccctgagctgtgtcccgtgtctgcacag
CCCCCCGTCGACATGGTCTGTCTCCACGATGGACGCTCTGCGGGGCCTGCTGCCCGTGCT
GGGCCAGCCCATCATCCGCAGCATCCCGCAG
gtgagaccccaatccccagcccgtggggatgcccggccacccgaggctcagcccaggtcc
tgctcgtcctcagggcatcgtggccgcgtggcggcaacgctcctctcgggacccatcctg
gcggcagcctgaacggaccatcctccggccgcggttccggcgggaagtggagagtgagtg
EXON 9  100 bp
tcccgtgtctgcacagccccccgtcgacatggtctgtctccacgatggacgctctgcggg
gcctgctgcccgtgctgggccagcccatcatccgcagcatcccgcaggtgagaccccaat
ccccagcccgtggggatgcccggccacccgaggctcagcccaggtcctgctcgtcctcag
GGCATCGTGGCCGCGTGGCGGCAACGCTCCTCTCGGGACCCATCCTGGCGGCAGCCTGAA
CGGACCATCCTCCGGCCGCGGTTCCGGCGGGAAGTGGAGA
gtgagtgccgtgccctgcgcagtctggcaccaggctgggcagcacccctgggggtgggca
tcactttagggtctcacctgcccctccctggctctgcagcacatcccattataatcacag
agagtggacagaatccctgtttgccagtgggtaaactgaggcacagggagggtcacaaat
EXON 10  179 bp
tggctctgcagcacatcccattataatcacagagagtggacagaatccctgtttgccagt
gggtaaactgaggcacagggagggtcacaaatggcccgaggtctcatctcacaggaggtg
tgggaggaagaaggggtcaaacgaactccggccctgacccctgacccctgtgccctgcag
AGACAGCCTGTCCTTCAGGCAAGAAGGCCCGCGAGATAGACGAGAGCCTCATCTTCTACA
AGAAGTGGGAGCTGGAAGCCTGCGTGGATGCGGCCCTGCTGGCCACCCAGATGGACCGCG
TGAACGCCATCCCCTTCACCTACGAGCAGCTGGACGTCCTAAAGCATAAACTGGATGAG
gtagttcatgactcaagttcccaccggcctgctgtgtccaagccatccccagcccctctg
ggagtgacatgggccctcctggtctcttggcctgcagctctacccacaaggttaccccga
gtctgtgatccagcacctgggctacctcttcctcaagatgagccctgaggacattcgcaa
EXON 11  156 bp
tgctggccacccagatggaccgcgtgaacgccatccccttcacctacgagcagctggacg
tcctaaagcataaactggatgaggtagttcatgactcaagttcccaccggcctgctgtgt
ccaagccatccccagcccctctgggagtgacatgggccctcctggtctcttggcctgcag
CTCTACCCACAAGGTTACCCCGAGTCTGTGATCCAGCACCTGGGCTACCTCTTCCTCAAG
ATGAGCCCTGAGGACATTCGCAAGTGGAATGTGACGTCCCTGGAGACCCTGAAGGCTTTG
CTTGAAGTCAACAAAGGGCACGAAATGAGTCCTCAG
gtgaccgtccggctcgggggtcatgtggcatgagattgggaagggctgaggggcagagtg
ggggacaaagcctgaggttgggcgggcctggggtcaggggcacggcctgaggttatgctg
gtggtggagggatacatctctccttgccacaaggctcctcggcggcccctcccacaggtg
EXON 12  167 bp
aacaaagggcacgaaatgagtcctcaggtgaccgtccggctcgggggtcatgtggcatga
gattgggaagggctgaggggcagagtgggggacaaagcctgaggttgggcgggcctgggg
tcaggggcacggcctgaggttatgctggtggtggagggatacatctctccttgccacaag
GCTCCTCGGCGGCCCCTCCCACAGGTGGCCACCCTGATCGACCGCTTTGTGAAGGGAAGG
GGCCAGCTAGACAAAGACACCCTAGACACCCTGACCGCCTTCTACCCTGGGTACCTGTGC
TCCCTCAGCCCCGAGGAGCTGAGCTCCGTGCCCCCCAGCAGCATCTG
gtgagtccccagaactctgcccggcaaggtgggtccgtgtgctggcgctcactgtccacc
caccgtgtccccagggcggtcaggccccaggacctggacacgtgtgacccaaggcagctg
gacgtcctctatcccaaggcccgccttgctttccagaacatgaacgggtccgaatacttc
EXON 13  128 bp
gccagctagacaaagacaccctagacaccctgaccgccttctaccctgggtacctgtgct
ccctcagccccgaggagctgagctccgtgccccccagcagcatctggtgagtccccagaa
ctctgcccggcaaggtgggtccgtgtgctggcgctcactgtccacccaccgtgtccccag
GGCGGTCAGGCCCCAGGACCTGGACACGTGTGACCCAAGGCAGCTGGACGTCCTCTATCC
CAAGGCCCGCCTTGCTTTCCAGAACATGAACGGGTCCGAATACTTCGTGAAGATCCAGTC
CTTCCTGG
gtgagccagggagtccctggccagggtgggcaacacaacgggggaagcacagactccact
cgggggtgccaggcctttgcctcgccgggccgtctgctgccagggtaactgggtggtcac
ccgccctctgccccccggggtgtgtatggccttaggggctgtgggttctgaccccagctc
EXON 14  95 bp
gcgccagccacctccagggtctcccacgcctgggggtcaggcggctaggcaaacccaggc
cctggaatccctaaggaaaaagggaagccctgtaaggcaagtgggcttcctgcagcctgt
ggtcaagggcctgggggtgtgaggtgaggcctcagctcgggcccctctcccggcgggcag
GTGGGGCCCCCACGGAGGATTTGAAGGCGCTCAGTCAGCAGAATGTGAGCATGGACTTGG
CCACGTTCATGAAGCTGCGGACGGATGCGGTGCTG
gtatggcgagcgggaggaggggcgtgtggaggaggggcccgtggaggaggggcgagtggg
aggaggggcgcgtggagggggggcgtgtgggggggtgcgtggaggaggggcgcgtggagg
aggggcgcgtggaggggggagcgtggggggcgtggaggaggggcgcgtggaggaggggcg
EXON 15  187 bp
tggggcctagggaagggcagccattgagctgaggtcagctggccggagacctccgaagtc
tggagaggctgcggtgggcatctgtgggtggggcagtttggacacaggagagcctggcag
ccctctggcggcgctgagggaaggagaccctccttgatggctgcccggggtctctggcag
CCGTTGACTGTGGCTGAGGTGCAGAAACTTCTGGGACCCCACGTGGAGGGCCTGAAGGCG
GAGGAGCGGCACCGCCCGGTGCGGGACTGGATCCTACGGCAGCGGCAGGACGACCTGGAC
ACGCTGGGGCTGGGGCTACAGGGCGGCATCCCCAACGGCTACCTGGTCCTAGACCTCAGC
ATGCAAG
gtgggcggggcggccaggccagggctgggggcagagctgggggcgtggaggtgggcgctc
tgagtcacccctctctctgtagaggccctctcggggacgccctgcctcctaggacctgga
cctgttctcaccgtcctggcactgctcctagcctccaccctggcctgagggccccactcc
EXON 16  218 bp
gatcctacggcagcggcaggacgacctggacacgctggggctggggctacagggcggcat
ccccaacggctacctggtcctagacctcagcatgcaaggtgggcggggcggccaggccag
ggctgggggcagagctgggggcgtggaggtgggcgctctgagtcacccctctctctgtag
AGGCCCTCTCGGGGACGCCCTGCCTCCTAGGACCTGGACCTGTTCTCACCGTCCTGGCAC
TGCTCCTAGCCTCCACCCTGGCCTGAGGGCCCCACTCCCTTGCTGGCCCCAGCCCTGCTG
GGGATCCCCGCCTGGCCAGGAGCAGGCACGGGTGGTCCCCGTTCCACCCCAAGAGAACTC
GCGCTCAGTAAACGGGAACATGCCCCCTGCAGACACGT
cttgtggcctccgaggactttctgtgaccccaccagcgtggcccctctccctctggtctt
gcgcccccaggccaggtgggggcccttggaggtcttcctgaccctgctgccactgtgctg
agggccaggccagcactcagggtggccccaggagccggtggtgggagtcctgtgcccctg