Gene KCNG4 Variant 2
DNA : 4.34 KbNT_024797
mRNA : 2199 bp NM_133490
CDS : 771 bp NP_597997
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  81 bp
aaaaaaaaaaatcccacctcaatcccccagggctctcctgcagctgctggagagagagat
gcagaatgaatgaacttctggtttctggaggaggcacgggaagaaagattggaaactgac
tctgctagaaactgctgttttggggatttttttcttccccttcatctccaccagaaacct
GTCCCTTCCCTGGGCACCAAGAGATGGGCTCCCCTTGCCTGGCAGAGAAACAGCTGGAAA
CTGGCTCCCTGAGACAAGAAG
gtgagttaaactggaggggaagagttactgcttgctgtagggtgggcgggggccaggggg
aagttgacgctgttagacatccttggcaaaagtgctggtttgagtgaattcctttcccgt
gctccagaaggagctgtttgccagctgtttggagagccgtagatggcaaaattgggttta
EXON 2  2118 bp
cccaagcacatagtaggtgctcaataaatatgtgttgaactaaaggttaaaagaacaagc
catgcagatgcagtcacaggaaagcacacgtaagaacatctgcagtcgtgacatccagga
ctctttgccccaagactgatttcccttccttttgcttgctctttgtcccttgggtgtcag
ACTGGTAAACCCAGCGCTTCCTACCTGGTGGTCTTCAGCAATGCCCATGCCTTCCAGAGA
CGGGGGCCTGCATCCCAGACACCACCACTATGGTTCCCACAGCCCTTGGAGTCAGCTCCT
GTCCAGCCCCATGGAGACGCCGTCCATCAAGGGCCTTTACTACCGGAGGGTGCGGAAGGT
GGGTGCCCTGGACGCCTCCCCAGTGGACCTGAAGAAGGAGATCCTGATCAACGTGGGGGG
CAGGAGGTATCTCCTCCCCTGGAGCACACTGGACCGGTTCCCGCTGAGCCGCCTGAGCAA
ACTCAGGCTCTGTCGGAGCTACGAGGAGATCGTGCAGCTCTGCGATGATTACGACGAGGA
CAGCCAGGAGTTCTTCTTCGACAGGAGCCCCAGCGCCTTCGGGGTGATCGTGAGCTTCCT
GGCGGCCGGGAAGCTGGTGCTTCTGCAGGAGATGTGCGCGCTGTCCTTCCAGGAGGAGCT
GGCCTACTGGGGCATCGAGGAGGCCCACCTGGAGAGGTGCTGCCTGCGGAAGCTGCTGAG
GAAGCTGGAGGAGCTGGAGGAGCTGGCCAAGCTGCACAGGGAGGACGTACTGAGGCAGCA
GAGGGAGACCCGCCGCCCCGCCTCGCACTCCTCGCGCTGGGGCCTGTGCATGAACCGGCT
GCGCGAGATGGTGGAAAACCCGCAGTCCGGGCTGCCCGGGAAGGTCTTCGCTTGCCTCTC
CATCCTCTTCGTGGCCACCACAGCCGTCAGCCTGTGTGTCAGCACCATGCCCGACCTCAG
GGCAGAGGAGGACCAGGTGAGCGGCCTCTGATGGCATTCACGGCTCCATCCCGCAGGGTG
CCTGGGCGGAGATGTCTTTTAGGGGCCCAAGAAAATGTCTTCAGATCTTAAAATAAGAAG
AAAAAAATGAATATTATCCAACATGGGTTATATTCATTATTAGGCCATCAGTCATAAAAG
ATAATTTTCCATCTTTTTTTTTTTTATTGGAGTCCTGCAAAGGCAAAAGTGCCTAAGGCT
CACCGTGAAAATCATTACGTGGCCCTCAGCCATGCGTGGACTCAGTGGGCCACACAGACA
CAGTGTCACCTCTCCCAGCTCTCCCGAGTCTGTGACTACAGGCAAATCACGCCACCTCCT
CTCTGAGCCTGTCTCCCACTCCGTGAAATGGGTAACATCACCTCGAAGGTTTACTCACCC
AGTGAACTCAACATGTGTTTACTGAACACCACTCTGTGCTAAGCCCTAGAGCAGGTCAAA
AACATAAAATCCCTGCCTTCTTGAGCTAACATTCTCCTGGGCATCCCCACTCCATTTTCA
GATGAGGAAACTGAGGCATGGGCCATTTATTTTCCTCGGAGCTCCACAGTAAGGATGCCA
ATGATGCAAAGGTCCCCGGCCTCAGTTTCCCTGCAGTGCTCAGTGTCTGGGCCAGTCTCA
CTGGATGGGAAACTCACAGATGAGCTGATCTGTAAGTCACTCTGCCCCAGGAGGCCAGAG
TAAAAAGTGCTGCTTGCCCACACCTTCGTCCCCTTTGCAGGGAGTTACAGGAGACCCCGA
GACACCCTCCCTCCACTCGGGAGCCAGATGGTCTGAGAAGTGAAATAAGAACCTAGCATT
TGGTTGAGAGGGTTATTGGAAAGCTTCAAACAGAGAATTAGATTGTTTCCTGATTTAAAA
AATCACTCCTCTCCAGCACCGAGCTCCCCCAGGGCTGCCCATCATCTTAATGTTTGGAGC
TTGCCTTGTAATCAACAGAGAGAGAAACTAAACACATACGTAAGATGGTGCTTGCTCTAT
TTGGCTCCTAACAGTTGCCAGCCCACCTAAGTTCTCTTCGCTTAAAGATATGTCCCAGGG
CAAGACAACAGGATCAGAGAACTTGCCAGATAGAAAAGACTTAAATGGAGAACCAGCCCA
TGCCTCACAGACAGTAGGATCCCAGTAAATATGGGTTGAATAAAATGTGTCTTGTCCAAC
CTACAAAAGTTTGGCCCTAAAAAAACCCACAAAATATTTGGACCTTTAAACAGCTTGTTT
TCCCATGGAGAAGATGACAATGCCAATCATAGGCATTTTTTCATTCTACAGCATAAAAAC
ATGAGATTTAAGAGCCTG
cttgttcacagaaatatttatgtgtggactctgcagtacaaagattaagacaaaacaagt
gacctccctaccccatttcttaagggtgccctgatcccagttaataaagaaaggcccctg
gatgctcacaagcctgttcctcttacagatttccagagaagggagaaattgtgtaggagc