Gene KCNG4 Variant 1
DNA : 17.53 KbNT_024797
mRNA : 1681 bp NM_172347
CDS : 1560 bp NP_758857
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  81 bp
aaaaaaaaaaatcccacctcaatcccccagggctctcctgcagctgctggagagagagat
gcagaatgaatgaacttctggtttctggaggaggcacgggaagaaagattggaaactgac
tctgctagaaactgctgttttggggatttttttcttccccttcatctccaccagaaacct
GTCCCTTCCCTGGGCACCAAGAGATGGGCTCCCCTTGCCTGGCAGAGAAACAGCTGGAAA
CTGGCTCCCTGAGACAAGAAG
gtgagttaaactggaggggaagagttactgcttgctgtagggtgggcgggggccaggggg
aagttgacgctgttagacatccttggcaaaagtgctggtttgagtgaattcctttcccgt
gctccagaaggagctgtttgccagctgtttggagagccgtagatggcaaaattgggttta
EXON 2  796 bp
cccaagcacatagtaggtgctcaataaatatgtgttgaactaaaggttaaaagaacaagc
catgcagatgcagtcacaggaaagcacacgtaagaacatctgcagtcgtgacatccagga
ctctttgccccaagactgatttcccttccttttgcttgctctttgtcccttgggtgtcag
ACTGGTAAACCCAGCGCTTCCTACCTGGTGGTCTTCAGCAATGCCCATGCCTTCCAGAGA
CGGGGGCCTGCATCCCAGACACCACCACTATGGTTCCCACAGCCCTTGGAGTCAGCTCCT
GTCCAGCCCCATGGAGACGCCGTCCATCAAGGGCCTTTACTACCGGAGGGTGCGGAAGGT
GGGTGCCCTGGACGCCTCCCCAGTGGACCTGAAGAAGGAGATCCTGATCAACGTGGGGGG
CAGGAGGTATCTCCTCCCCTGGAGCACACTGGACCGGTTCCCGCTGAGCCGCCTGAGCAA
ACTCAGGCTCTGTCGGAGCTACGAGGAGATCGTGCAGCTCTGCGATGATTACGACGAGGA
CAGCCAGGAGTTCTTCTTCGACAGGAGCCCCAGCGCCTTCGGGGTGATCGTGAGCTTCCT
GGCGGCCGGGAAGCTGGTGCTTCTGCAGGAGATGTGCGCGCTGTCCTTCCAGGAGGAGCT
GGCCTACTGGGGCATCGAGGAGGCCCACCTGGAGAGGTGCTGCCTGCGGAAGCTGCTGAG
GAAGCTGGAGGAGCTGGAGGAGCTGGCCAAGCTGCACAGGGAGGACGTACTGAGGCAGCA
GAGGGAGACCCGCCGCCCCGCCTCGCACTCCTCGCGCTGGGGCCTGTGCATGAACCGGCT
GCGCGAGATGGTGGAAAACCCGCAGTCCGGGCTGCCCGGGAAGGTCTTCGCTTGCCTCTC
CATCCTCTTCGTGGCCACCACAGCCGTCAGCCTGTGTGTCAGCACCATGCCCGACCTCAG
GGCAGAGGAGGACCAG
gtgagcggcctctgatggcattcacggctccatcccgcagggtgcctgggcggagatgtc
ttttaggggcccaagaaaatgtcttcagatcttaaaataagaagaaaaaaatgaatatta
tccaacatgggttatattcattattaggccatcagtcataaaagataattttccatcttt
EXON 3  804 bp
agtctctgacctagccgatctgctgtgtacccagccacaactggaaaactgtgtaaaagg
aggttctggtggacgactaagtttacagcacaaagctcatgggcatgaagtcgtcccccg
atttccagcacagttgcaagtccactctctaccccgcgttgttgcctcttctccccgcag
GGCGAATGCTCTCGGAAGTGCTACTATATTTTCATCGTGGAGACCATCTGCGTGGCCTGG
TTCTCCCTGGAGTTCTGCCTGCGGTTTGTCCAGGCCCAAGACAAGTGTCAGTTCTTCCAG
GGGCCCCTGAACATCATCGACATCCTGGCCATCTCCCCATACTACGTGTCGCTGGCGGTG
TCTGAGGAGCCCCCGGAGGACGGCGAGAGGCCGAGCGGGAGCTCCTACCTGGAGAAGGTG
GGGCTGGTCCTGCGTGTGCTGCGAGCGCTGCGCATCCTCTACGTGATGCGCCTGGCTCGC
CACTCGCTGGGGCTGCAGACGCTGGGGCTCACCGTGCGCCGTTGCACACGTGAGTTCGGC
CTGCTCCTTCTCTTCCTGGCCGTGGCCATCACCCTCTTCTCCCCTTTGGTCTACGTGGCC
GAGAAGGAGTCCGGGCGGGTGCTGGAGTTCACCAGCATCCCCGCCTCCTATTGGTGGGCC
ATCATCTCCATGACAACGGTGGGCTACGGGGACATGGTGCCCCGCAGTGTGCCAGGCCAG
ATGGTGGCCCTCAGCAGCATCCTGAGCGGGATCCTCATCATGGCCTTCCCGGCCACGTCT
ATCTTCCACACCTTCTCCCACTCCTACCTGGAGCTCAAGAAGGAGCAGGAGCAGCTTCAG
GCCCGCCTCCGCCACCTCCAAAACACCGGTCCAGCCAGTGAATGTGAACTCCTGGACCCC
CATGTGGCCAGTGAACATGAGCTCATGAACGATGTCAATGACCTAATCCTGGAGGGCCCA
GCCTTGCCTATCATGCACATGTAA
ctcagcaccccccatgactacatggtaacctcaacccatcaccctgcctgaaacacactc
aagggtaccccgcatagaccacctggtggtgtttctagagcccagggaagactttcaaag
ctggaggggcataaggccacagaggctgtgtgtctgtgatccttgtccctcggggccccg