Gene HPR Variant 1
DNA : 3.19 KbNT_010498
mRNA : 1044 bp NM_020995
CDS : 1044 bp NP_066275
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  88 bp
cttggtcctagcacttccatatattgattttcttttctggctgcttagtgggaggagtgt
gtgtgtatgcatgtgtgtgtgtgcgtgtgtgtgtgtgtgtacatgcctgtgtgtgtggat
gcatgcatgtgctgtgaagcagggagaccagctttccgctccttcttgttttctctctgc
AGTGACCTGGGAGCTGTCATTTCCCTCCTGCTCTGGGGACGACAGCTTTTTGCACTGTAC
TCAGGCAATGATGTCACGGATATTTCAG
gtcagtctttgagttgggtaggagcatgcatccctggcactgccacatcccactctgact
ctctcgggtctgcattctttctttgagaacacacagttccccattcttatcctgacctct
gggctttcaggactgccaagaacattggggatcctgccagaaatgaggggagcttgagct
EXON 2  102 bp
tcaggactgccaagaacattggggatcctgccagaaatgaggggagcttgagctttcgtt
ggcttctatttggggtagaaggagattgatgtgcagagcagcttccactcatctgacttt
tcatgggtctctgggaacaatttccaaatggtaaactctctggcttctctctctttgcag
ATGACCGCTTCCCGAAGCCCCCTGAGATTGCAAATGGCTATGTGGAGCACTTGTTTCGCT
ACCAGTGTAAGAACTACTACAGACTGCGCACAGAAGGAGATG
gtaagacctggacaactatctctgtgctctacctacaacccctgctctgacatttccatg
atgggtggtgctgaggtgatttgccagaaagttcgttgctctccttggagccaggagatt
tagattctgataagcgttttgtcgccagtagccatggccctttgggcagactaacttttg
EXON 3  75 bp
acttggcttccagcacagcactctttcccttcctccttctcgtattctctctcctttctc
ccttcctgtctgcctcctttcttcttcttctttttaattcttctccttaaatgccttctc
actctgctctgggtgcagacttgacttttcctttggctcatttcttgccttttgtttcag
GAGTATACACCTTAAATGATAAGAAGCAGTGGATAAATAAGGCTGTTGGAGATAAACTTC
CTGAATGTGAAGCAG
gtgggtgctgagcactgagcacttaagagagcaggcaggcgtccagcggggaacgtccta
gaggcacagccttccagtgcggcttcctctgagcacacaagagccaggaggagggatgtg
ggagaaccgcagctggccagggagagacttaagcagttaggtgatgactccctaaggatc
EXON 4  779 bp
aattaaaaaaattattttaaaactgcaactattggaaatgagatcagcaggtggtaagga
caaagcatttaaatctttccagtttatgcagcagtgacagccgccaatgctttcacccct
ttctcagatggaaaggctcttgcacatttccactcacgagtgtcttgctctccttgacag
TATGTGGGAAGCCCAAGAATCCGGCAAACCCAGTGCAGCGGATCCTGGGTGGACACCTGG
ATGCCAAAGGCAGCTTTCCCTGGCAGGCTAAGATGGTTTCCCACCATAATCTCACCACAG
GGGCCACGCTGATCAATGAACAATGGCTGCTGACCACGGCTAAAAATCTCTTCCTGAACC
ATTCAGAAAATGCAACAGCGAAAGACATTGCCCCTACTTTAACACTCTATGTGGGGAAAA
AGCAGCTTGTAGAGATTGAGAAGGTGGTTCTACACCCTAACTACCACCAGGTAGATATTG
GGCTCATCAAACTCAAACAGAAGGTGCTTGTTAATGAGAGAGTGATGCCCATCTGCCTAC
CTTCAAAGAATTATGCAGAAGTAGGGCGTGTGGGTTACGTGTCTGGCTGGGGACAAAGTG
ACAACTTTAAACTTACTGACCATCTGAAGTATGTCATGCTGCCTGTGGCTGACCAATACG
ATTGCATAACGCATTATGAAGGCAGCACATGCCCCAAATGGAAGGCACCGAAGAGCCCTG
TAGGGGTGCAGCCCATACTGAACGAACACACCTTCTGTGTCGGCATGTCTAAGTACCAGG
AAGACACCTGCTATGGCGATGCGGGCAGTGCCTTTGCCGTTCACGACCTGGAGGAGGACA
CCTGGTACGCGGCTGGGATCCTAAGCTTTGATAAGAGCTGTGCTGTGGCTGAGTATGGTG
TGTATGTGAAGGTGACTTCCATCCAGCACTGGGTTCAGAAGACCATAGCTGAGAACTAA
tgcaaggctggccggaagcccttgcctgaaagcaagatttcagcctggaagagggcaaag
tggacgggagtggacaggagtggatgcgataagatgtggtttgaagctgatgggtgccag
ccctgcattgctgagtcaatcaataaagagctttcttttgacccatttctgtgttgtgtt