Gene GFER Variant 1
DNA : 3.44 KbNT_037887
mRNA : 2246 bp NM_005262
CDS : 378 bp NP_005253
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  168 bp
tccggctcctgtggccgcgcgctggcctggaggctgacctggaggctcatctggaggccg
agctgacccggcaggccttgcgcgggcaacatggcggcgcccggcgagcggggccgcttc
cacggcgggaacctcttcttcctgccggggggcgcgcgctccgagatgatggacgacctg
GCGACCGACGCGCGGGGCCGGGGCGCGGGGCGGAGAGACGCGGCCGCCTCGGCCTCGACG
CCAGCCCAGGCGCCGACCTCCGATTCTCCTGTCGCCGAGGACGCCTCCCGGAGGCGGCCG
TGCCGGGCCTGCGTCGACTTCAAGACGTGGATGCGGACGCAGCAGAAG
gtgcagttccctgcccgatttctcccagccccgcgcagcccctgtccccgcccccgccca
ggtaccccggcagagcttcccagggttgcctgtccctgaaccttgccccccgggtaggcc
cggccttacagccttcatccgcgcgtgggttggatcgtctgcaggactttggccggagtc
EXON 2  197 bp
tgtccctgaaccttgccccccgggtaggcccggccttacagccttcatccgcgcgtgggt
tggatcgtctgcaggactttggccggagtccagtgggccaccggctgggccgtacagtgg
ggagctttgggcgcctttgttcggagaatgaactcactctcggtcggcctgcttccgcag
CGGGACACCAAGTTTAGGGAGGACTGCCCGCCGGATCGCGAGGAACTGGGCCGCCACAGC
TGGGCTGTCCTCCACACCCTGGCCGCCTACTACCCCGACCTGCCCACCCCAGAACAGCAG
CAAGACATGGCCCAGTTCATACATTTATTTTCTAAGTTTTACCCCTGTGAGGAGTGTGCT
GAAGACCTAAGAAAAAG
gtaagatgtgtttgcacgcagcagagctttgcactggagcctgggcctggggctcctggc
tgacgttatagcggggaacgtagagaaacggatgcagaggtggcagaagtttgctgagga
gcagggacctccaacaggtgaggactggggctatctgagcctcctcctctcgtctcagaa
EXON 3  1881 bp
acccggggagctgcagggtcagccctgttctgggagtgcctgtaccttggagcataaggg
cactcccaggtgtagttcacagcagtgccccagctctccttccttgacagcagacaggga
actggcaggggcagtggagccgctgcgtcctctcattctttacctgctctccctacacag
GCTGTGCAGGAACCACCCAGACACCCGCACCCGGGCATGCTTCACACAGTGGCTGTGCCA
CCTGCACAATGAAGTGAACCGCAAGCTGGGCAAGCCTGACTTCGACTGCTCAAAAGTGGA
TGAGCGCTGGCGCGACGGCTGGAAGGATGGCTCCTGTGACTAGAGGGTGGTCAGCCAGAG
CTCATGGGACAGCTAGCCAGGCATGGTTGGATAGGGGCAGGGCACTCATTAAAGTGCATC
ACAGCCAGAGCCTGTTGTGTCTCAGTTGGGTGGTCCCCAGGACACTGCCTGTGGGGACCT
GCCCTGCCCCTCTTAGGTTTGGAGCAGAAGTGGAGGTGCCCACAGCAGGTACCCACTGGC
CCCCTCCTCAGTGGAGACCCCAAGGAGCTGCAGCTGAACTGCAGGGGAGGGAAGGAGGAG
CAGCCTGGGCTGCCCCTTGACATTCAGGATGTAGCTTCCTGCCCACCGCATACCCTGGCG
CCTCACTCCTCACACGGGAAGACAGCGGGCCTGGCTGGGCATCCCTGTGCCTGTCCCTGG
CGGCCAGGCCATTGCCTTCCCACTATGCAGCCAGGGATGCCCCTGCCCCCCATGGCTCTG
TGCTGCTCACTTTAGGGGGCTCAATTCTCCACTCTGCTCAGTCCCTACAGGGAAAGCTCA
GGTCGGGTCTTTCTGAGGGTCCACCAGCCATCCTACCCTCTCCCTGCCTGGCACATGCCT
GCCAGCGTTGTGTCATGCCTGTCCACAGGGGATTCGTGGGGCTCACTTCATCAGAGTTTG
AAGCCCAAATGAAACGCTGAAGTGACTGAGAACCTGGCTTCAGTATATTTTCTGCTGGGG
CTTAATAAAGCAGTAGACAGGGCTTGTTCCATCCCTCTGTGCTCAGCTGCATTTCCTGCT
GGGGTCCTGGTTCCTCAGGAGAGAGAGACCACAGGGTGAGAGTGAGCCAGGAACAGCAAG
GACGTTGATTGGTTGGGGCAGGGGGGCCAGAGTAGCTGATGTAGGAGTACTGGGAGGCCA
GACGGCACGAGGTCTCCAAGGCCCCAGCAAAGCCATGGCTTCTACCCCTAGTTCCCCTGA
CAGGAAGTTCTTGGCGGGTTTGGAGCCAGGGGATGGCATGGAGTGATGTGGCTTTGAAGG
GTCCTCTGGCTGCTGAGCTGGGATGAGGCAGGTAAGGGTGGAACAGGAGGGGTGGGGAGG
AAGCCGGGGCAGTCACCGAGTGACCACCAAGAGGAAGACCCACCCCACGGCGGGGACAGA
TGCGGGGTACGTTAAAGGGAGAGCCAGAGAACTCATGGGGTGAGGATGGAGTCCGAGGAG
ACTGCTGGGAGCCGCCGTGTGGGTCAGAGATGGAGAAGGCTGAGTGCAGCAAGGTGGGGG
GTGACTGGGACCCAGCCTTTGGGCCTCCCCAGCCAGAGCAGCCCAGCAACAGTGTGTCCT
GTGGTCATAAAACTCCAGGGACCTCTATCCTCCAGGAGTCTCAGCCTTTCCCTGGGCGCA
GGCCCACCTTGGCATGGCCGCCTCAGGCCTCCATGGAGGGAGCTGCTATGTCCCCACCAG
ATTGGCCCCGTGCGGCTGCTGGCTTCTGTAGAGGCTGCCCAGAGGGGCCAGGTGGCACAA
ATAAGAGAGGGGAGATGGGGGGCAGCCAGGAGAGGAGGTGTCCCTTCCTCGCCCAGACAC
AGCGCGCTTCTCTCTGGCCTTTCCCGAGGCCTGTGAGTGCCTCAGGAAGCAGCTGGGCCC
TCTGGGAAGGCTGTGTTCAGCTTAGGAACATACCGCCTGTATCTGCTGTCCCTCCCCTGC
CCCCCTGCCCCCCCCACCGCCTTCCCTTTTTCCCTGTCTTCCTTAAAGTTTCACTCCTGA
ATAAAACTTCACTTTGCCTTA
gaatctgtttttctttttgttgttgttttgtttttctgagacagagtctagctctgtcgc
ccaggctggagtgcagtggagcagtctcggctcactgcaacctccatctcccgggttcaa
gcaatttctcctgcctcagcctcccgagcagctgggatcacaggcgcccaccaccacccc