Gene COTL1 Variant 1
DNA : 52.46 KbNT_024797
mRNA : 1823 bp NM_021149
CDS : 429 bp NP_066972
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  226 bp
gagttgcgcaagccttccggtctgggattggccgccagagaatcaagacgctccgccccc
gcagcccgacggccaatgaagaggcgggccgccgcctgggcggccaatgggcgcgggggg
gcggggcgggccacggcctggggtccccgcgcgctctccgtccgcagtggaagccgccgc
CGCGCTCGCAGCTTGCAGGCGCCGCGTAGCCGTCGCCACCGCCGCCAGCCCGTGCGCCCT
CGGCGCGTACCCGCCGCGCTCCCATCCCCGCCGCCGGCCAGGGGCGCGCTCGGCCGCCCC
GGACAGTGTCCCGCTGCGGCTCCGCGGCGATGGCCACCAAGATCGACAAAGAGGCTTGCC
GGGCGGCGTACAACCTGGTGCGCGACGACGGCTCGGCCGTCATCTG
gtaggaacttttcattcgtctccacgccccgctccccgggctcgcgcggggcctcgtgca
ccgagccggcctccaggcgggacggattcgggcctcccgcgctgtcttcctcgccttatt
ccgggacggcgtgccaggcccccgcgggcttctccgtggccagcgcgtctgttagattgt
EXON 2  83 bp
aggcgggacggattcgggcctcccgcgctgtcttcctcgccttattccgggacggcgtgc
caggcccccgcgggcttctccgtggccagcgcgtctgttagattgtcctctgcaagcgcc
gcgtcgcgcggccaccagcgctgatgtgtgtgtgtgtttttttcttctcccaacccaaag
GGTGACTTTTAAATATGACGGCTCCACCATCGTCCCCGGCGAGCAGGGAGCGGAGTACCA
GCACTTCATCCAGCAGTGCACAG
gtagggaggcgcgcctgccgggcggatgcgcggtcgttgggaggttgtctgcacccgggg
agccccggccagagcgaacccgggaggaaccggtggccacatggggtgcccctggcgcat
ggcgtgggaggaacccggtgtgagcgttttaaggcctcataaaaccttctcccctctgga
EXON 3  158 bp
tgacaagggcagcggatgagtgcttccctcctgtcctctgcacatggtgctcccagggaa
ctgcaccggtctcctgctgtgctgctccaggcgcactcgtggctcacagcctctccccag
ggacatgacatgggggtgttttaacgcagcaccatgttctcttttcgcttttggccacag
ATGACGTCCGGTTGTTTGCCTTCGTGCGCTTCACCACCGGGGATGCCATGAGCAAGAGGT
CCAAGTTTGCCCTCATCACGTGGATCGGTGAGAACGTCAGCGGGCTGCAGCGCGCCAAAA
CCGGGACGGACAAGACCCTGGTGAAGGAGGTCGTACAG
gtactgagttcctccagagtctggaggtcaaagctcgccaagggtcaccatcctgcaagg
agggagagggctgggttcgactcctgggtctgtagcttagctgtgacttgggacaagcca
tgctatgtctctgcaccagtaaagccattggtgaaatgtcaccagaattgtttcaggatg
EXON 4  1356 bp
tgttcaatttccattgactctgctgctgaatttccattgactgactctgctgctgaattt
ccatttccatctctcatcagggttttcagtgctttgcttcccagtgtgttgcctgagcca
ccctcacatcctgtgccttccttcttaataggaacgctgtgttttcctttgttcttgcag
AATTTCGCTAAGGAGTTTGTGATCAGTGATCGGAAGGAGCTGGAGGAAGATTTCATCAAG
AGCGAGCTGAAGAAGGCGGGGGGAGCCAATTACGACGCCCAGACGGAGTAACCCCAGCCC
CCGCCACACCACCCCTTGCCAAAGTCATCTGCCTGCTCCCCGGGGGAGAGGACCGCCGGC
CTCAGCTACTAGCCCACCAGCCCACCAGGGAGAAAAGAAGCCATGAGAGGCAGCGCCCGC
CACCCTGTGTCCACAGCCCCCACCTTCCCGCTTCCCTTAGAACCCTGCCGTGTCCTATCT
CATGACGCTCATGGAACCTCTTTCTTTGATCTTCTTTTTCTTTTCTCCCCCTCTTTTTTG
TTCTAAAGAAAAGTCATTTTGATGCAAGGTCCTGCCTGCCATCAGATCCGAGGTGCCTCC
TGCAGTGACCCCTTTTCCTGGCATTTCTCTTCCACGCGACGAGGTCTGCCTAGTGAGATC
TGCATGACCTCACGTTGCTTTCCAGAGCCCGGGCCTATTTTGCCATCTCAGTTTTCCTGG
ACCCTGCTTCCTGTGTACCACTGAGGGGCAGCTGGGCCAGGAGCTGTGCCCGGTGCCTGC
AGCCTTCATAAGCACACACGTCCATTCCCTACTAAGGCCCAGACCTCCTGGTATCTGCCC
CGGGCTCCCTCATCCCACCTCCATCCGGAGTTGCCTAAGATGCATGTCCAGCATAGGCAG
GATTGCTCGGTGGTGAGAAGGTTAGGTCCGGCTCAGACTGAATAAGAAGAGATAAAATTT
GCCTTAAAACTTACCTGGCAGTGGCTTTGCTGCACGGTCTGAAACCACCTGTTCCCACCC
TCTTGACCGAAATTTCCTTGTGACACAGAGAAGGGCAAAGGTCTGAGCCCAGAGTTGACG
GAGGGAGTATTTCAGGGTTCACTTCAGGGGCTCCCAAAGCGACAAGATCGTTAGGGAGAG
AGGCCCAGGGTGGGGACTGGGAATTTAAGGAGAGCTGGGAACGGATCCCTTAGGTTCAGG
AAGCTTCTGTGTAAGCTGCGAGGATGGCTTGGGCCGAAGGGTTGCTCTGCCCGCCGCGCT
AGCTGTGAGCTGAGCAAAGCCCTGGGCTCACAGCACCCCAAAAGCCTGTGGCTTCAGTCC
TGCGTCTGCACCACACATTCAAAAGGATCGTTTTGTTTTGTTTTTAAAGAAAGGTGAGAT
TGGCTTGGTTCTTCATGAGCACATTTGATATAGCTCTTTTTCTGTTTTTCCTTGCTCATT
TCGTTTTGGGGAAGAAATCTGTACTGTATTGGGATTGTAAAGAACATCTCTGCACTCAGA
CAGTTTACAGAAATAAATGTTTTTTTTGTTTTTCAG
aaaacagtttggtttctgatttgtcctacaaagttctttttttttttttgctgtaataac
agaggcagtcatcatcgccttcagatttaataggtgtttgcggagctgctgaggcggggc
acattcacattcaattgcttatttaattcttagcaaccataagaaacaggtgctgctttt