Gene CLDN9 Variant 1
DNA : 0.65 KbNT_010552
mRNA : 654 bp NM_020982
CDS : 654 bp NP_066192
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  654 bp
cacggagaggaggcgcctttcaagaggcgcctttcatggaactgaggactggcctggctt
ggggacaccaacaagccttccccctcctgctggacacagagacacccacccagcacacca
gacacaccctctgagtcacctaggccgcctggggctgagaagacctaaccgaggggccag
ATGGCTTCGACCGGCTTAGAACTGCTGGGCATGACCCTGGCTGTGCTGGGCTGGCTGGGG
ACCCTGGTGTCCTGCGCCCTGCCCCTGTGGAAGGTGACCGCCTTCATCGGCAACAGCATC
GTGGTGGCCCAGGTGGTGTGGGAGGGCCTGTGGATGTCCTGCGTGGTGCAGAGCACGGGC
CAGATGCAGTGCAAGGTGTACGACTCACTGCTGGCTCTGCCGCAGGACCTGCAGGCCGCA
CGTGCCCTCTGTGTCATTGCCCTCCTGCTGGCCCTGCTTGGCCTCCTGGTGGCCATCACA
GGTGCCCAGTGTACCACGTGTGTGGAGGACGAAGGTGCCAAGGCCCGTATCGTGCTCACC
GCGGGGGTCATCCTCCTCCTCGCCGGCATCCTGGTGCTCATCCCTGTGTGCTGGACGGCG
CACGCCATCATCCAGGACTTCTACAACCCCCTGGTGGCTGAGGCCCTCAAGCGGGAGCTG
GGGGCCTCCCTCTACCTGGGCTGGGCGGCGGCTGCACTGCTTATGCTGGGCGGGGGGCTC
CTCTGCTGCACGTGCCCCCCGCCCCAGGTCGAGCGGCCCCGCGGACCTCGGCTGGGCTAC
TCCATCCCCTCCCGCTCGGGTGCATCTGGACTGGACAAGAGGGACTACGTGTGA
ggcggaggtttcccctgggagcccactgctccccactgccccgccctttcgaccttggcc
tgatgaccagatgccctgctccatcacaacctccttccccaggaaaacccactttccaaa
agcccaagctacacctggctgcagggctgggtcagctggcctggctgagctcttctcagt