Gene CDH1 Variant 1
DNA : 98.25 KbNT_010498
mRNA : 4815 bp NM_004360
CDS : 2649 bp NP_004351
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  172 bp
actccaggctagagggtcaccgcgtctatgcgaggccgggtgggcgggccgtcagctccg
ccctggggaggggtccgcgctgctgattggctgtggccggcaggtgaaccctcagccaat
cagcggtacggggggcggtgcctccggggctcacctggctgcagccacgcaccccctctc
AGTGGCGTCGGAACTGCAAAGCACCTGTGAGCTTGCGGAAGTCAGTTCAGACTCCAGCCC
GCTCCAGCCCGGCCCGACCCGACCGCACCCGGCGCCTGCCCTCGCTCGGCGTCCCCGGCC
AGCCATGGGCCCTTGGAGCCGCAGCCTCTCGGCGCTGCTGCTGCTGCTGCAG
gtaccccggatcccctgacttgcgagggacgcattcgggccgcaagctccgcgccccagc
cctgcgccccttcctctcccgtcgtcaccgcttcccttcttccaagaaagttcgggtcct
gaggagcggagcggcctggaagcctcgcgcgctccggaccccccagtgatgggagtgggg
EXON 2  115 bp
cggccgtaggtttcggggtgggggagggtgacgtcgctgcccgcccgtcccggggctgcg
ggctggggtcctcccccaatcccgacgccgggagcgagggaggggcggcgctgttggttt
cggtgagcaggagggaaccctccgagtcacccggttccatctacctttcccccaccccag
GTCTCCTCTTGGCTCTGCCAGGAGCCGGAGCCCTGCCACCCTGGCTTTGACGCCGAGAGC
TACACGTTCACGGTGCCCCGGCGCCACCTGGAGAGAGGCCGCGTCCTGGGCAGAG
gtgagggcgcgctgccggtgtccctgggcggagtagggaggggttggaaaggggccgaga
aattgcactcccacacccctgggttgcaatgggcaagctccctccttggctcaaacgaca
ccccttggaatttacgcagatttggggatccaaacgtttacgactgaacactgtggtgga
EXON 3  224 bp
tcatcctgtagttgtgaagaacattatggtgatagctttgttgttctgtcaccagattat
ggtttgttttggttgtgtttggttttgtgggagtcttcccacaagttcgctctttggaga
aggaatgctcttgtctttaatctgtccaatttcctaatctctgtgatttctgccctgcag
TGAATTTTGAAGATTGCACCGGTCGACAAAGGACAGCCTATTTTTCCCTCGACACCCGAT
TCAAAGTGGGCACAGATGGTGTGATTACAGTCAAAAGGCCTCTACGGTTTCATAACCCAC
AGATCCATTTCTTGGTCTACGCCTGGGACTCCACCTACAGAAAGTTTTCCACCAAAGTCA
CGCTGAATACAGTGGGGCACCACCACCGCCCCCCGCCCCATCAG
gtatgttggcatttttctgagaagttcgctgttgttttagtgcgctgtctaatccaggtt
tctcagccttggtaccgttgacattttgggctggatgattttgtgttgtaggggttgtcc
tgtgcactgtgtaggatgtttagcaagcatccctggccttaactggttagacaccagtag
EXON 4  144 bp
tttgattggtcattttggtggatatatataatttgtcattgataagagaatgtgtcatta
aattcaaactgtacactgcccacagaaggctggggacgctgtctggctaggttggactgt
tagacctgaagtatccgtcttgaattgtcttatcttgttcctcatcttctttccttttag
GCCTCCGTTTCTGGAATCCAAGCAGAATTGCTCACATTTCCCAACTCCTCTCCTGGCCTC
AGAAGACAGAAGAGAGACTGGGTTATTCCTCCCATCAGCTGCCCAGAAAATGAAAAAGGC
CCATTTCCTAAAAACCTGGTTCAG
gtagagaaagaagttctctgtttctctgggagggatttggcagagaagtaccaaggagag
aaagggaaaagacccagtgttgggatccttctttactaattctttttctttcattttgtc
ttcagatcaaatccaacaaagacaaagaaggcaaggttttctacagcatcactggccaag
EXON 5  156 bp
tcccatcagctgcccagaaaatgaaaaaggcccatttcctaaaaacctggttcaggtaga
gaaagaagttctctgtttctctgggagggatttggcagagaagtaccaaggagagaaagg
gaaaagacccagtgttgggatccttctttactaattctttttctttcattttgtcttcag
ATCAAATCCAACAAAGACAAAGAAGGCAAGGTTTTCTACAGCATCACTGGCCAAGGAGCT
GACACACCCCCTGTTGGTGTCTTTATTATTGAAAGAGAAACAGGATGGCTGAAGGTGACA
GAGCCTCTGGATAGAGAACGCATTGCCACATACACT
gtaagtatctcttagaagcttgttgacaccggggtaacatccacccaggattttttggtc
aacccatgctggatccgcagatcagaggctctgaacacatgaggagcttaacttgacacc
tcttgacctgttgctaaggagaagtgatgggagaacgtgggacagtttggggttgttaat
EXON 6  145 bp
taccttgttataatctcactgaagcagcagcagcacatgtgtgagaaaagtcacccactg
ggggtctcagagcctaggaaggtgtggcagccaggggggcgcactctgctctggctgggc
cccttctcccatgttttcttcctcatcagagctcaagtcaccctcacttggttctttcag
CTCTTCTCTCACGCTGTGTCATCCAACGGGAATGCAGTTGAGGATCCAATGGAGATTTTG
ATCACGGTAACCGATCAGAATGACAACAAGCCCGAATTCACCCAGGAGGTCTTTAAGGGG
TCTGTCATGGAAGGTGCTCTTCCAG
gtatatccactaatgagaatctgaatactcagaaagactcttaggttctttggaccccaa
agtgttgtccaagcccaaaggttgtgtaactaaagctgatccttcctacggacagaactt
cttggcaagccattgttgtgttatatgcatgtgtgtaacagtctacctgtggaaacatat
EXON 7  176 bp
tagtttgagctttctttctcccctagcactttggtaagaattctaggaattagggaactc
tgacacggtaccacccccatgtcccctcctttatccctcagggcagaattggattaagca
gtattgacccagtcccaaagtgcagcttgtctaaaccttcatctccttgaactcttccag
GAACCTCTGTGATGGAGGTCACAGCCACAGACGCGGACGATGATGTGAACACCTACAATG
CCGCCATCGCTTACACCATCCTCAGCCAAGATCCTGAGCTCCCTGACAAAAATATGTTCA
CCATTAACAGGAACACAGGAGTCATCAGTGTGGTCACCACTGGGCTGGACCGAGAG
gtcaggggtcaggaggatccagagggtgtggaggacaaatgtgtattagctcaatcccgt
ggacaaagcaaaatcctgctaggccagttgtcagttaatacagtgatggtctaagctttg
catctaagcttgtgcccagaggttccgtgcctagaagacaggcaggctggcatgaagcac
EXON 8  129 bp
taatacagtgatggtctaagctttgcatctaagcttgtgcccagaggttccgtgcctaga
agacaggcaggctggcatgaagcacatggttaaatattctggttccatgtgttgggctgg
gctaggccaaaggtggctagtgttcctggtcctgacttggttgtgtcgatctctctgcag
AGTTTCCCTACGTATACCCTGGTGGTTCAAGCTGCTGACCTTCAAGGTGAGGGGTTAAGC
ACAACAGCAACAGCTGTGATCACAGTCACTGACACCAACGATAATCCTCCGATCTTCAAT
CCCACCACG
gtaattctataactccttagagggtttccaaagaaaggtcttttgttgttcatgaactaa
gtgtcaccactgctcatgggcgaagtctttgaaaactctctccagactagagaatgttaa
ctttaaacttaaaagcaagcatcttgagatggcagttgtcttttagtatcttttttccac
EXON 9  183 bp
cttgagcccaggaggttgaggctacagtgagccatgatcgctcaaatacactccagcctg
gtgacagtgagatcttatctcaaaagaacaacaaaaaaagaggaatcctttagccccctg
agactcagctctgctagcagtcttggtactttgtaaatgacacatctctttgctctgcag
TACAAGGGTCAGGTGCCTGAGAACGAGGCTAACGTCGTAATCACCACACTGAAAGTGACT
GATGCTGATGCCCCCAATACCCCAGCGTGGGAGGCTGTATACACCATATTGAATGATGAT
GGTGGACAATTTGTCGTCACCACAAATCCAGTGAACAACGATGGCATTTTGAAAACAGCA
AAG
gtttgtatggtacctggcaagatgcagaaactggcatcctcacagctgttcatacccttg
tcccctggtatcttcttagaagtagattcgctttggcagggggacagggtgactttccca
gattgtagtggaccatgtgggatttgcagtggctcttcctgctcatgtaagaaatcaaga
EXON 10  245 bp
agatttgagaagccatggtaagtaattgtggtttctgccattgaaagtcatggcagaaac
cacagttacttttgcaccaacctaatatattaccaaaagcaacagttaaggatttaattt
tatttttactaacacaaaatgtttcgttttgtttttaacttcattgtttctgctctctag
GGCTTGGATTTTGAGGCCAAGCAGCAGTACATTCTACACGTAGCAGTGACGAATGTGGTA
CCTTTTGAGGTCTCTCTCACCACCTCCACAGCCACCGTCACCGTGGATGTGCTGGATGTG
AATGAAGCCCCCATCTTTGTGCCTCCTGAAAAGAGAGTGGAAGTGTCCGAGGACTTTGGC
GTGGGCCAGGAAATCACATCCTACACTGCCCAGGAGCCAGACACATTTATGGAACAGAAA
ATAAC
gtaagtgtgaggatttttcaactgacttgcagcaactggttattttatatcattttatat
gtaaatcaataatatgtacttcatggcattttgtcatttgtctgtacaagaccattctct
taatttattttttattccctttatctgtgctcctttcacctgttcccttcccttcacaga
EXON 11  146 bp
cccacctcagcctcccaaagtgttgggattacaggcatgagccaccgcgaccggcctatt
gttggttttcaaaataaaaacgttggaagtaaccatataactgaagaagcgcttaagccg
ttttcagctacatgttgtttgctggtcctattctaaaagccagagcttgtccccgttcag
ATATCGGATTTGGAGAGACACTGCCAACTGGCTGGAGATTAATCCGGACACTGGTGCCAT
TTCCACTCGGGCTGAGCTGGACAGGGAGGATTTTGAGCACGTGAAGAACAGCACGTACAC
AGCCCTAATCATAGCTACAGACAATG
gtaagggggcctcatctgagcctttgctgcctcgacctcctagctagttcagttccttgc
ccctcccttcttttggagggaagagttcattctttttcttttatcctttttgtttgctgg
attgatttgtataaatgtatggagtacaagggtaattttgttacatgcatagatgtgtag
EXON 12  225 bp
ctgcccacctgggagtggaggtcctttgggattggtgggacaggaggttctgcgggtgga
gtggggcctggtgagggaccactgaagagccaggacaagatctagacttggtctggtgga
aggcaatggggattcattactgttgccaagctgccacattttctgtgtattttctcttag
GTTCTCCAGTTGCTACTGGAACAGGGACACTTCTGCTGATCCTGTCTGATGTGAATGACA
ACGCCCCCATACCAGAACCTCGAACTATATTCTTCTGTGAGAGGAATCCAAAGCCTCAGG
TCATAAACATCATTGATGCAGACCTTCCTCCCAATACATCTCCCTTCACAGCAGAACTAA
CACACGGGGCGAGTGCCAACTGGACCATTCAGTACAACGACCCAA
gtgggtacctgagttttattttggcaactttgctccaactgccatgcttcccttccccca
gatccccacctttcaatttcccttctcaacttctagatgtcaccccttccattgatactt
gcttccttgtcccttctgtctttgaggccttgctccaaaggtctttttcctttcctggta
EXON 13  228 bp
aaataaagctttttacagcaaaaaaaaaaaaaaaaaagtacatacctaaataaaacccaa
gcagctctgctctcttcactcggcttgcgggtgtctttagttcactagcaattttattct
ggaatgagctttttattttcctcccctggtctcatcatttctttttattgctttctccag
CCCAAGAATCTATCATTTTGAAGCCAAAGATGGCCTTAGAGGTGGGTGACTACAAAATCA
ATCTCAAGCTCATGGATAACCAGAATAAAGACCAAGTGACCACCTTAGAGGTCAGCGTGT
GTGACTGTGAAGGGGCCGCTGGCGTCTGTAGGAAGGCACAGCCTGTCGAAGCAGGATTGC
AAATTCCTGCCATTCTGGGGATTCTTGGAGGAATTCTTGCTTTGCTAA
gtaagtccagctggcaagtgactcagcctttgacttaaaaaaatggaggaggtttatttc
ctggaaatgatttttgttcttatattaataaggatataggttagctgatgtgggaaagag
actcccaagttatgccagcctccataaaatagaagtttgtctcttactgaacatttcaga
EXON 14  131 bp
acataccgacttcagggatgtgagtgtcacgtggattgacatcttcaagtgtattgaagg
cagctagtggctgtctaactgccccctgtctggtatgaggggtgctctgtgatagctgct
gcttctggccttctttatctttggctctcaacacttgctctgtctcccccaccatcccag
TTCTGATTCTGCTGCTCTTGCTGTTTCTTCGGAGGAGAGCGGTGGTCAAAGAGCCCTTAC
TGCCCCCAGAGGATGACACCCGGGACAACGTTTATTACTATGATGAAGAAGGAGGCGGAG
AAGAGGACCAG
gtgggttttgaaaaccttggtagctcagtggtgatctctttattcggaagaagcaatgat
tagtaagaggtaggcatttgaaacagctctgaatcactttggatattatctttttaaggc
cttacccaagaaagtagacattgtcattgaccatcatcatcatcacatcatcaccaacac
EXON 15  144 bp
ttccagtgctatttgggagacttttagcttgaaaactgtcattttgcattaaactggtaa
agatcatacagttggcagtgaaggcatcatccaaccataatctataaactgaacatagcc
ctgtgtgtatgactatttctttcctactcttcattgtacttcaaccttttttctccaaag
GACTTTGACTTGAGCCAGCTGCACAGGGGCCTGGACGCTCGGCCTGAAGTGACTCGTAAC
GACGTTGCACCAACCCTCATGAGTGTCCCCCGGTATCTTCCCCGCCCTGCCAATCCCGAT
GAAATTGGAAATTTTATTGATGAA
gtaagtaatccacgtggaaagccaaagcatggctcatctctaagctcaggaggagttgtg
tcaaaaatgagaaaaagagtctttagattctttcctttactatgttttcagcttgcctga
gccctggagccctgttttcctttttctttttttttctttttctttttttttttttttgag
EXON 16  2252 bp
tgtgcttctgcatccttccatgacagtgtgtataaatgtacgttgttggtgttcactgct
ccgtggtgtgccacaagtctgggtgcattgtcgtaccttacatattgctagacttcttgc
cccagatgacaggtgtgcccttcctttcactaaaagatgcttttgtcccttcttctttag
AATCTGAAAGCGGCTGATACTGACCCCACAGCCCCGCCTTATGATTCTCTGCTCGTGTTT
GACTATGAAGGAAGCGGTTCCGAAGCTGCTAGTCTGAGCTCCCTGAACTCCTCAGAGTCA
GACAAAGACCAGGACTATGACTACTTGAACGAATGGGGCAATCGCTTCAAGAAGCTGGCT
GACATGTACGGAGGCGGCGAGGACGACTAGGGGACTCGAGAGAGGCGGGCCCCAGACCCA
TGTGCTGGGAAATGCAGAAATCACGTTGCTGGTGGTTTTTCAGCTCCCTTCCCTTGAGAT
GAGTTTCTGGGGAAAAAAAAGAGACTGGTTAGTGATGCAGTTAGTATAGCTTTATACTCT
CTCCACTTTATAGCTCTAATAAGTTTGTGTTAGAAAAGTTTCGACTTATTTCTTAAAGCT
TTTTTTTTTTTCCCATCACTCTTTACATGGTGGTGATGTCCAAAAGATACCCAAATTTTA
ATATTCCAGAAGAACAACTTTAGCATCAGAAGGTTCACCCAGCACCTTGCAGATTTTCTT
AAGGAATTTTGTCTCACTTTTAAAAAGAAGGGGAGAAGTCAGCTACTCTAGTTCTGTTGT
TTTGTGTATATAATTTTTTAAAAAAAATTTGTGTGCTTCTGCTCATTACTACACTGGTGT
GTCCCTCTGCCTTTTTTTTTTTTTTAAGACAGGGTCTCATTCTATCGGCCAGGCTGGAGT
GCAGTGGTGCAATCACAGCTCACTGCAGCCTTGTCCTCCCAGGCTCAAGCTATCCTTGCA
CCTCAGCCTCCCAAGTAGCTGGGACCACAGGCATGCACCACTACGCATGACTAATTTTTT
AAATATTTGAGACGGGGTCTCCCTGTGTTACCCAGGCTGGTCTCAAACTCCTGGGCTCAA
GTGATCCTCCCATCTTGGCCTCCCAGAGTATTGGGATTACAGACATGAGCCACTGCACCT
GCCCAGCTCCCCAACTCCCTGCCATTTTTTAAGAGACAGTTTCGCTCCATCGCCCAGGCC
TGGGATGCAGTGATGTGATCATAGCTCACTGTAACCTCAAACTCTGGGGCTCAAGCAGTT
CTCCCACCAGCCTCCTTTTTATTTTTTTGTACAGATGGGGTCTTGCTATGTTGCCCAAGC
TGGTCTTAAACTCCTGGCCTCAAGCAATCCTTCTGCCTTGGCCCCCCAAAGTGCTGGGAT
TGTGGGCATGAGCTGCTGTGCCCAGCCTCCATGTTTTAATATCAACTCTCACTCCTGAAT
TCAGTTGCTTTGCCCAAGATAGGAGTTCTCTGATGCAGAAATTATTGGGCTCTTTTAGGG
TAAGAAGTTTGTGTCTTTGTCTGGCCACATCTTGACTAGGTATTGTCTACTCTGAAGACC
TTTAATGGCTTCCCTCTTTCATCTCCTGAGTATGTAACTTGCAATGGGCAGCTATCCAGT
GACTTGTTCTGAGTAAGTGTGTTCATTAATGTTTATTTAGCTCTGAAGCAAGAGTGATAT
ACTCCAGGACTTAGAATAGTGCCTAAAGTGCTGCAGCCAAAGACAGAGCGGAACTATGAA
AAGTGGGCTTGGAGATGGCAGGAGAGCTTGTCATTGAGCCTGGCAATTTAGCAAACTGAT
GCTGAGGATGATTGAGGTGGGTCTACCTCATCTCTGAAAATTCTGGAAGGAATGGAGGAG
TCTCAACATGTGTTTCTGACACAAGATCCGTGGTTTGTACTCAAAGCCCAGAATCCCCAA
GTGCCTGCTTTTGATGATGTCTACAGAAAATGCTGGCTGAGCTGAACACATTTGCCCAAT
TCCAGGTGTGCACAGAAAACCGAGAATATTCAAAATTCCAAATTTTTTTCTTAGGAGCAA
GAAGAAAATGTGGCCCTAAAGGGGGTTAGTTGAGGGGTAGGGGGTAGTGAGGATCTTGAT
TTGGATCTCTTTTTATTTAAATGTGAATTTCAACTTTTGACAATCAAAGAAAAGACTTTT
GTTGAAATAGCTTTACTGTTTCTCAAGTGTTTTGGAGAAAAAAATCAACCCTGCAATCAC
TTTTTGGAATTGTCTTGATTTTTCGGCAGTTCAAGCTATATCGAATATAGTTCTGTGTAG
AGAATGTCACTGTAGTTTTGAGTGTATACATGTGTGGGTGCTGATAATTGTGTATTTTCT
TTGGGGGTGGAAAAGGAAAACAATTCAAGCTGAGAAAAGTATTCTCAAAGATGCATTTTT
ATAAATTTTATTAAACAATTTTGTTAAACCAT
tgtcaaatttgttttatttgattccaccacatttccagtcaagagaaaagatgcatggag
atggcctcagtcaaaacgtggagaaagaggccgggcgcggtggctcatgcctgtaatctc
agcacttcgggaggccgaggcaggtagatcacttgagctcaggagtttgagaccagcctg