--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (116385 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (35 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       2883       2959   0    Initial     77    48    Marginal
tgtggttgagcacctcgaggagtggagctgttctcctcagtttcacccattttacccctg
ccaagttagtggtataatagagaaagggacatagctgcatcttttgtgatacagacctta
aggcctgtggaattttcgaaacattcaaggggcctgtgggtagtgtgtaggtcctgagat
ATGGAGCTTACAACCAGCTGGGTAAAGTACACCATTAATGCTGAGCAGCACCGTACAGCA
TATGCTATACGTATAGT
gtatgtgttttatttttatttgttttgagacagggtcttgctttgtttcctaggctggag
tgcagtggcacgttcatggctcactgcagcctcgacctcctgggctcaagcagtcctccc
accttagcctcccaagtagctggggctgcaggcaagtgccaccatgcctggctaattttt

Exon  2 +       8438       8556   2   Internal    119    78        Good
ccagtgttgctaaatccagtggttagctctcagtccctatcttactggatctgtcagtag
tgtcagacaagtggagtaccccttctgcagttcagcctttcgtcacttggccgctgggac
actaaggtgtgttcttggttttcctcctgtcgcacaggttgtttcttcctcatctcatag
CCGGAACACTCTAGGCCTCGAACTTAGTGCCTTCATCCAGGACACCTATAACCCAACATC
TCTCTCCTCAGCTCCAGTTCTCGAGTCTCCAGCTGTCTGCTTGACATCCAAGCTGGTTT
gtgagacgggtcacatctcccctctagctcacctcctttagctctcactggctgtgctgc
agctccctcggtcttcttactgctcttcagaccttctgggcatgttcctgctccaggcct
ttggcctggctccctgcctctgcttggaccgtgctctccctgagaatctgcttgactaaa

Exon  3 +      10558      10777   2   Terminal    220    46    Marginal
cctcaccagctgtagatatccagtgttctgacaacatcaaattaaatgtgtgttaaacca
aatccatcatcttcctctcaggttagtgcctcctctgtcttgccctggttctgttaatga
cctcattttctagctagtcaaatgatgaacctgagtcatctttaacttcctcttctatag
CGCCCCCCTGCTTCCAGACCTGTTGATGCTGCTGCTAACGTATCTGTGTCCTGACCCTGA
CCTTTCCCTCCATTCCCTCTGCTTTGATCAAGCTGTCATTGTCTCTTGCTTTGGTTGTTG
CTGTCATGACCGGTCCTCTCTTCCAGGTTCTGCGTCCCTCTGTCCATCTTCCGTACTGCT
GAGCTGCCTCATAGAGCTCAGATGTGATCATGCCACGTGA
accccagtcattcagagcagagggttcccactgttgtctgagaccaagttttcatcatgg
tagagtaacatgggccctgaattttaagtttcttacttactttgaggtccctcagtaagg
atgaagatggttcattaaatacttaaagtgatttatttggagtatctatgaaagacttcc

Exon  4 +      12318      12347   1   Internal     30    88        Good
ggggtgaaagaggctaatgggaagggaaggaaatgggcatagagagagaaaaggtctgtg
tttcataattgcactctgtgctagtcgtcgttaaggggccctcatgcataccgcgtaggg
tatttgatttaatctctcatagccaccctgccaggtaggtattatgttcccattttatag
TTGAGGAAGATAAGGACGCTGAGGCCCAGG
gtgggtaatgctaagtaacttctccaaagttacctagtgttctcttcatctgggctaaga
aaataaaaaaccaaaaaaacagaaatcagaattacctagtgagttgacagagccaggatt
cagttctaaggttccaactccaaggcccatgtttttttctagatcactaggtttcttttt

Exon  5 +      18169      18212   0    Initial     44    46    Marginal
accagttgtcttgccatccctgtatgagagtgaaagatgtaatttcagttcattatggtc
ggtgtcatgttgaagcccacaaggagtgaggagctctgagggtagggaagggggaactgc
attaggcttcacagagttggggaccttttcgaggagtcaggagcattctagatagaggaa
ATGGTGTGTGTGAAGACATGGAACTGTTATGTGGAGAGAAAAGG
gtgagtttgggtttggctgaggcagagggtgggtgggtggctgtggatggtgaggtgggg
acagtaagtcagctaggttagggccaggtgatgaaatggtttaatcacccctggtggtca
ggtagcaaagaccctgggcggcagtggtgatggggcttgcaggtgaaagatacttgagag

Exon  6 +      23988      24038   0    Initial     51    74        Good
cttttttttaaatagaggaataaagtgagatttccacttcaatatgctgtgctttttttt
ttttttttttaaaggaagtgtcagctggacgcggtggctcgtgcctctaatcccagcact
tttggaggctgaggcaggcggatcgcttgagccctggagtttaagaccagcctgggcaac
ATGGCGAAACCCCAGCTCTACAAAAAATACAAAAATCAGCTGGATGTGGTG
gtgtgcagctgtggtcccagctacttgggaggctgaggtagaaggatagcttgagcccgg
gagatagagtttgtgccactgtactccagcctgggcgacagagcaagacctgtgcctcca
gaaaacaaaaggaaaaggaaaatatctacgggctgggatgcaaaagagcagtagtgaccg

Exon  7 +      35807      35919   1   Internal    113    66    Marginal
tcacctcagacgcagaaaaatattgtatgatttattctttctatcttaaagaatccgctg
gttttgacatcatttacattatatgcagagagacatgtttaaataataataagatagccc
agtcttgtctaatttcatgtattttcatagctttcttttgttgccatttaacttttccag
AGGAGCTTCTTAATAACTTTGCCCAGCAAATAGGAGCCTGGAGATTCTGCCTGTACTTTC
TCTCCAGCACTAGGAATGACTATGTAATGATGTACAGTTTAACAGTTTTTGAG
gtaagttgtcagtaattttatactcttctgaaaaggattttgtagttctattgccatatc
attagcactagactagagctgtaatgtgctgggagagggtagctcagctctgggatgtcg
tcccacatactgtctttatgtagttgtctggtgtttggggcatcttccatcttccacact

Exon  8 +      37044      37241   0   Internal    198   100   Excellent
aatgggactgttgtgtcctaagatttgaatacttttattattcttattgccatattgccc
caaacctttatttaaagagggattcttgtttattgaagtgataatagctacctgtgggat
gaaaagcagttatttttgtgtataggttgttaacttaaaagatgtatatttgtttttcag
AATCTGATCAATAAAATGTGGCTTGGGGTCCCATCTCAGGATAAGATGGAAATCCGTAGC
TGTCTGCCCAAACTCCTTTTGGCTCACCATAAAACCTTACCTTACTTTATCCGGAACAAG
CTCTGCAAAGTTATTGTTGATATTGGACGTCAGGATTGGCCCATGTTCTACCACGACTTT
TTTACTAACATTTTACAG
gtaaggatatgcctaaggaaactttatcttgtgaatagtttgtttgttgaagtgattatt
tccttgtcctgaagaggacttttaagattagcagtttggaactgcagtagtgaggttatt
gtaggactgattatcgcattcactttatatttataagacatattgtatctttgtgaggtg

Exon  9 +      43231      43419   0   Terminal    189   100   Excellent
aagtgctgggattacaggcgtgagccattggagctggcctctaagtgatgtttctgaagt
gttgatttatgttcatgtaagattaaacacacacagatgcttcacagctttaatgctact
gagtcctctttgtactttattagtccaacactctgctcagaacatgctttttcctggcag
TTGATCCAGTCCCCTGTGACAACCCCCCTTGGGCTGATCATGTTGAAGACAACTTCAGAA
GAGCTGGCTTGTCCCCGTGAGGACCTCAGTGTGGCTCGGAAGGAGGAGTTGCGGAAGCTG
CTACTGGACCAGGTGCAGACAGTGCTTGGGCTACTGACAGGTGAGCAGTATGGTAGTGCC
CAGAGATAG
aggcctgcccgcaggcacccagagttcaggccttggcactcagcagctttgagcagttgt
ttgcgctgtttctgagatagcatgaaaatgggaagctgcgttcccaacacctatagccca
gggtctagcacacagtaggactacaaaatagatttgtaccttattttcctcgtagtcttt

Exon 10 +      45421      45476   0    Initial     56    59    Marginal
tctacttagtctgtctctatggatttgccttttttggaattctcataaaaatggaagcat
acaatatgtgatcttttgtgtctggctttttcacttaacataatgctttcaagatttatt
caggttttaatatgaaaaatttgagaataagatattttcaaaagcctttgtgatcacctt
ATGTTCCGGGTTCTGTACGGGTACAAAGAGGAAGAAAACACAGTTCCCACCCTCAG
gtaatttacacttgagtggggagacacaagtaaacagttaaagatgttttaagagctaaa
tagaggtatgttttatgtgcaggaattcctgaaggaggtgacagctgaatggaattttga
gcgacagacaggtggcatttagtctggtggaaaggtgatgttgaaattgggaggaggaga

Exon 11 +      45864      45972   0    Initial    109    68    Marginal
gtagaaggaacagcagacagttgagcatagcaaggccgcgtctgtcgggtgagctgaagc
ctgggtcaggtgaggctagatgaggtcagcagaagccaggatttccagcctgtttcctgc
atgaggaacgaaaaaggattggtggcaggtttgtggggaacgaaaagttgagtttgggat
ATGCACGTAGCATTGTCCAGGAAGCAGGTGGACATGCAGGTCTGTTACTGCCTTGCCTTG
TTTCTGAAGCCCCCATCGTGTGAGGCAGAGCTTGGTGTATATAGTCAAG
gtgagtttgggccaagaacaggagacttgagaggcttcagaatatattgaagccatagca
gtggatgagtcactctagcagtgagagtgaaatgagaggagaagcaggtcagtcagggaa
cctggggaaacgtgtgtttaaatgactcatgggcagaggatggaagtaatagtgaaaggg

Exon 12 +      54084      54176   1   Internal     93    88        Good
tttctttttttaaagacagagtcttgctctgtcacccaggctggagtgcagtggtaaaat
cgtagctcactgcagccttgacctccccgggctcaagcgatcctcccacttcagcctcct
gagtagctgggcctataggcatgtgccaccatgcttggctaatttttgtattttttgtag
AGACGGGGTGTCGCTATGTTGCCCAAGCTGGTTTTGAACTCCTGGGCTCAAGTGATCTGC
CCGCCTCAGCCTACCGAAATGCTGGGATTACAG
gtgtgagccaccgctcctggcctgttgttatagttttaaatatttttcttcttttgtctt
ctctaaaataattttatagctttttttcccctgtttcattttgtttgatttcctttagtc
tagtgctttcaaaaatcaagcaagcataagaatcacttggagtgcttataagaacacaga

Exon 13 +      56621      57074   1   Internal    454    93   Excellent
aaatttcctaattagtgtttaactttgagcatatagattttatttttttatttcataggt
aactaaactgatacatatatgtatacatatatatatatatttttttttgaaggagaatta
cttaaagtcatttgtaagagatttgatgctggatagcttaaaagcctttcttattttcag
GTGACTTACTGAGTAACCTGTTGCAGAGTCCCAGTTCAGCCAAACTGTTGAATCAGCCAA
TTCCCATCCTTGATGTGGAGAGTGAGTATATCTGTTCCCTGGCTTTGGAGTGCCTGGCCC
ATCTCTTCAGTTGGATTCCTCTGTCTGCCAGCATCACCCCATCCCTCCTTACCACCATCT
TCCACTTTGCACGATTTGGCTGTGACATCCGGGCCAGAAAGATGGCGTCAGTTAACGGCA
GCAGCCAGAACTGTGTCTCGGGTCAGGAGCGCGGCCGGCTGGGGGTCCTGGCCATGTCCT
GCATCAATGAACTCATGTCCAAGAACTGTGTGCCTATGGAATTTGAGGAGTATTTACTGC
GTATGTTCCAGCAGACTTTCTACCTCCTGCAGAAAATCACCAAGGATAACAATGCCCACA
CAGTGAAGAGCAGGCTAGAAGAGCTCGATGAGAG
gtaatgaaaccaagtgtggagctggtgtgccccaagaaagggccctgactgtttaccatg
ctgtgctgcatggcatctgtaatcctctttgatttcagaatatggggctcctggtgagga
acagaaaggtaggtgtgtgccagtaagtctgagattagctggaagggcttgggtggttaa

Exon 14 +      57377      57461   2   Terminal     85    87        Good
agaaaggtaggtgtgtgccagtaagtctgagattagctggaagggcttgggtggttaagg
gaagtgactgagtttgaaaaatgcttgtgccttgtgtaggtttgttgtcttttctcccca
tccatctcctgtcctcccttctactcctcttgcccccttttccttactatttgcttgcag
GTCTGAGGTGGTGCAGGGACTGAGACTGCTGCTCCTGCGTAGCCAAGAACAGGAGAAGAG
GTCCGTGGAGGTACAGGAGTTATAA
tcgccttttgtcacttggtgtcagtttttactatttgacttttcccaagtgaacatcctg
cagtattcaggaatgttgttgttattgtgagttttacaccaatggcaagttttcatcaaa
ctataggagggatgttaatgtgtgcacaggttaatgtagcacacagctgtgtttctttgt

Exon 15 +      60364      60490   2   Internal    127    85        Good
ggtggttaatggaatgaagggttgcctgtcctgtaggtaattgttgcaggcctttatatt
tttaaaagaaaatatattacaaatttgtatagttctgtactgaaagaactttggattgaa
tttaagttctaaggaggtggctgggtttcttattgtcaccttttgtcttgtctcatttag
CTATATCGAGAAGTTTACTGACTTTCTTCGGCTCTTTGTGAGTGTTCACCTAAGAAGAAT
CGAGTCTTACTCCCAGTTCCCTGTGGTGGAGTTTTTGACACTTTTGTTCAAGTACACATT
TCATCAG
gtaaagcaccaaagtcatccttcccttccagagaaaaggtttattaccttgttactttga
gaagaaagaactttttctttcaactttattttccaaacattaatataatgcttattatgt
gaagagtcacaggtttaatcttcctaacatccctgtgaagtaggttctattaccattgtc

Exon 16 +      64767      64852   0    Initial     86    65    Marginal
accacttggaagatagaatggtatcattagtttcttaaagaaacctggatttgtagccct
ggaatctgaaaagtaaattggggtctaggtccattttaaaaatgggtctgtgaaggtttt
gaaaagttaggcgacttcaaaaatggagccagcccatcatcttgatgaccggaatgaacc
ATGTCCACAGCAACTATCAGAGGCCAGGTCATGGGCGGCCTGTGGGCAGTGCACAAGCCC
TCGCAGTGGGGCCTGCAGGAATGGAT
gtgaaaggtggtgcttcaggttatacagggtgtgtctgctcacctttcccccagccttga
gcatatagcaagtcctcaattcacatgcatgaagtttatatgtataattataaagtactt
tgacggagccataatacttggatttatgtggtaacctttcccaaaggcacttccatatgc

Exon 17 +      66961      67070   0   Internal    110    90   Excellent
ggttcaggagggcccaatggtatagaccgactaaaagccaccagttttggttaccaggaa
actggggaatctaggcttatgatttcatcattctgctggaattaaacactggcatgtgtg
tgtttctaaggaatagtagcattaaataatttcattgtctggattttttttgtaccatag
CCTACTCATGAAGGTTACTTCTCTTGTTTGGATATCTGGACGCTGTTTTTGGACTATCTG
ACAAGTAAAATTAAAAGTCGTCTTGGAGACAAGGAAGCAGTTCTCAACAG
gtaaactcctcaaacactgaaaactagatatggtcattttgccagttattctagtggcct
aagggacagccatgcatttggaccttttcagtgaagctgagtcatgtaagctgtttaggc
aataatgccattgagcatttccttttttttctcctttaagtattttgttaagacttttta

Exon 18 +      76194      76349   0   Terminal    156    50    Marginal
agggtgttgcctccacctctgagggtgcacgatactagttctgggaatgtggaatgaagc
tggaaaccggaaccagttgcttctgccaggtgtctgttgctggggcagcactgccaggac
agcaagcccacaggaaggatgcagtccttttgtcccttctgccttccagtctccctccag
TGTCCCTGCTGGCAGAACCTAACAGACCGAAACAAAGTGTCCTTTGAGTCTCAGCCCCAG
CATCATAGCTTTGGAGAGCAGATTGATGTGGAGAGCTTACTAACCAGCACTGGTGGTTTG
CTCTATGAATGGGAGCAGTCCCTTAACTTATCTTAG
aagcgtttcaggataggcgagtatttaggcaacatgatttgttcttgaaaatgagcagtt
tgttggtccttgtggtagcaattgttgcttataacttggtatcttctgagttgggttctt
attacatgtgggaaatatccaaacctaccgctctgagtatttctttgagaaattattctt

Exon 19 +      77839      77947   2   Internal    109   100   Excellent
ctctgcttctcttccatgggcgcacacacgtaccaacccataaactcagcctcaggaatt
tcgatgctctttttccatggtgatcaacatagacaccatttcttttatagtgcaggaggc
attttccaaattctaagctgaaagcctcctttcaatgttgaatttctccctgccacatag
GTACGAAGATGCCCTGGTGCTCCTGCTCACAGAGGTGTTGAATCGAATCCAGTTCAGATA
CAACCAAGCCCAGCTGGAGGAGTTGGATGATGAGACTCTGGATGACGAT
gtaagcggcatgccctgattgattttttgtcgctgtcatgttgtgacatcaatcagaatg
gggacctggaacccagagccctctgctccgaagactgttctgaaaccagagtagtcttct
ggtttgagtcgtacatttgaaatttttaatctcctgctggtcccttttggcttattaacc

Exon 20 +      79230      79342   0   Internal    113    80        Good
tttttgtgaaattaattcattgtttttaaaaaattctagcttggcctttttatagtacca
gataacctggttccatcattttccatttcttcaaaattttatgtctgagagtggtcttga
ggttggcaaggaagatgagaggattctgggagagctgattctcctgtgcttcccctacag
CAGCAGACGGAGTGGCAGCGGTACTTACGGCAGAGCTTGGAGGTGGTGGCCAAAGTGATG
GAGCTCCTGCCCACGCACGCCTTCTCCACACTGGTAATGTGCTGTCCGGGGGA
gtggagagtgtagcgatttctctgtacacagagcatggctggttgactcccctggatctc
tctctctctcccctctttcccctctatgtaatttttaaaaacagaataattaccataagt
gatgctcaaactgaacaaatattaacatttccacaaaatattaaaccaacttttggaacc

Exon 21 +      87321      87473   2   Internal    153   100   Excellent
ataccgggcccagtttccctgctcagtactgggaagcagcccgtgggttgctttgtttcg
cgaattggttttgctgctggttttgctgtgtgtggcttgctggaccagctgttatctgta
gtatctaaagcgtggtcttcctgtgaaaaactgtctggcgtgttgtgttccaggacacag
GTTGAACATCACGGCGGAGAACGACTGCCGGCGGCTGCACTGCTCCCTGAGAGACTTGAG
CTCCCTGCTGCAGGCCGTGGGCCGCCTGGCCGAGTACTTTATCGGGGATGTGTTTGCTGC
ACGGTTCAATGATGCCCTCACAGTCGTGGAAAG
gtaggctggcagttaccttatggagctgttccttcttcagagttcagctttaccttcttg
tgtgaggggcagcatattgccaaatagcttctgctctggccccgggtaaatctaggctct
gccacatacaagctgatagggaacaaattacttaacctctctgaacttcaggtccctcat

Exon 22 +      88076      88160   2   Internal     85    79        Good
agtcaactccattgtccaagtaggcagctagatgcacagggtgctttttgtgttttttcc
agtcccattagggcctcgggagtgaaagctgggtagcctccacgcctggcccgaaaggtg
gttcccagcctttcaccactgggctccttttcttctccttcctcttgggtctcacaccag
GTTTACAGATGCACTTGTTGAGGAACACTTGATTCTACTCAGTCAGCAGTCCCTCCTCCC
TTTCTCCCCTCGAAAAACCCAAGAT
gtaagtgacaggacatttagatcatttcaaggcagctgttgaattggttagatcaaaact
gagtagatgtggatccagcccaaagccaagacacctgatgcttcgactggcccagcagcc
gcatcactggtgacgtgcagaggggaagtgagcctcaggagcctgggtgcatgcatgcca

Exon 23 +      88227      88307   0    Initial     81    46    Marginal
cttctccttcctcttgggtctcacaccaggtttacagatgcacttgttgaggaacacttg
attctactcagtcagcagtccctcctccctttctcccctcgaaaaacccaagatgtaagt
gacaggacatttagatcatttcaaggcagctgttgaattggttagatcaaaactgagtag
ATGTGGATCCAGCCCAAAGCCAAGACACCTGATGCTTCGACTGGCCCAGCAGCCGCATCA
CTGGTGACGTGCAGAGGGGAA
gtgagcctcaggagcctgggtgcatgcatgccagacttcactgccacatcttagctgaaa
agcaaagatagccaaggggcttaaatcccttaaaagccagattcatattaataataaaaa
cagcacacagtagtaggacattttctgtgtttttgcacatggtctttcattttgttctgt

Exon 24 +      91400      91496   2   Terminal     97    77        Good
ataaatctttatgcatatctcagattatttccttggcataaaattgaaagtctggtcttg
attcttttttgtatatgaaaaagtctgcccttacgctctttgctggtaccagccttgtct
gttttgtctgtcttagttcataagctgaatgttcttgtttacctgcctctttgccaacag
GTTGGTCAAAGTCACTCTGTACGGATCTCAGATAAAATTGTACAACATTGAAACTGCTGT
GCCATCAGTATTGAAACCTGACCTCATTGATGTGTAA
gtctagagtttgatgtttgtgcatttttaggaaagaccttgcccccaatctccaaataat
ttgattgagaaaaaggaacagtagtggctgccatgaatcagggaaaaactcttaaactgc
aaacctagaaagagagagagatttttttgactatatgtctggggcagaggcggttggaga

Exon 25 +      94239      94390   1   Terminal    152    48    Marginal
ttggaggctgcagtgagctatgattgtgccactgcactcctgcctgggcaacagagcgag
accctgtttcagcaacataaataagtaaataaagtgatacctgcctatatcctaattctg
tctgctgaaagctcctagaaacagtgacaatccagtagcaatcctatcccttttccccag
GTCTTGGTTTCTCAAATCCATTCTCCAGAGCACCTTGGAGAAAAAAGCTCAAGTCTGGGG
GGGTGATGTTGGACAATCTTGCCAAGTCAGCAAGTAAGGAAGTGCTCAGTGACTGTTGGG
AACATGTGAAGAGGATGCAGGACCCAGCTTGA
aagggttcttcctggtcaaacttgacagttcagtcatcaagaaagaataaggacaataat
gaattataccagtttgaatgaaaataatctactcattcaaagtgattaacaggctaggcc
ggtgcagtgcctcacacctgcaatcccagccctttgggaggccaaggcagaaggatcgct

Exon 26 +      95700      95844   2   Internal    145    93   Excellent
agatgatgaatatcttagtttttaggttctacgtgaaccggtaaatgatttctatgctgt
tgcccatgtcttagaacagcaaatgcagtggatgcaattcttacctcctatgaaaatgag
ttgaacgctaatatattttcaccttaacctttaaaatcacatcttcttttctttctgcag
GCATGCTCAGTCCCTGGCTGCGCTGCAGGCTTACTCTCACTGGTTAGCACAGTATTGCAG
TGAAGTTCACCGGCAGAACACGCAGCAGTTCGTGACACTCATCTCTACTACCATGGATGC
AATCACACCTCTAATCAGCACCAAG
gtctcgaaacagcaaagcctacaccttttatctaactctctgtctctccttctgttccta
tacccatttactagaaaatctaaatatgacacagagttagacccataaatctttctgctg
ttatacatctgttttatttcatgttcctttttagttgtagcctacatgcattcagataca

Exon 27 +     100115     100261   0   Internal    147   100   Excellent
catgacagagaagatgggcttctcttgtagtcatcataggaaaaattcttgagctagata
gggcctaggtggtgtaatttggaaaccaagaatgacacatagcttgtggctgcctcagca
aagttcgaatcccagtcttacagggatgtggtgagctgacgtgccctcttccctctgcag
GTCCAAGACAAGCTGCTGCTATCTGCGTGCCACTTACTGGTCTCACTGGCCACCACCGTG
CGGCCCGTCTTTCTGATCAGCATCCCTGCAGTGCAGAAAGTATTCAACAGAATCACTGAT
GCCTCTGCCCTGCGACTTGTCGATAAG
gtgaggccccagagctcccccggggtccccagggctgtgtgactgagacccaaggaagct
gaggaagaagagtctggcctttgattttgtactcagagcttacaggctgtaccagcatag
acagatttcttattgtgtggcactgacacagactcagtgattctcatcgtgcccattcta

Exon 28 +     101159     101348   0   Internal    190    94   Excellent
tcatcttcctccctaagctgccttccagttggaccaaaggccttgcccaggttgcaagaa
acgagcctgggggctagggttccaggtgtgcagccagcgggtgctgaaggctgtgttggg
catgccgcaccacggtctttggctctgacctctgatggatgcctttggggtctcttgtag
GCCCAGGTGTTGGTGTGCCGAGCCCTCTCTAACATCTTGCTGCTTCCGTGGCCAAACCTT
CCAGAGAATGAGCAGCAGTGGCCCGTGCGCTCCATCAACCACGCCAGCCTCATCTCTGCA
CTCTCCCGGGACTATCGCAACCTGAAGCCCAGTGCTGTTGCCCCACAGAGAAAGATGCCA
CTGGATGACA
gtaagtgacccctaggctaggacagctggggaaggaggtaggcaggcattgttctttgtg
gcagatgagatttgccccggaggctcctgaggtaaattttttttgttcatagtcccacag
aggctgagcaggaagtcatacttgggggtgggatcctgctacctttggaattcagttaag

Exon 29 +     105488     105643   1   Internal    156    90   Excellent
caaaaactaaaacataaagagaggagaatttatattgtaatcaagagactgttcctttag
tgagactcgtgtgatcatcttcttggtacctttgcaagtttcctccctctcccttgtgtc
tcctcttaccatgctttctccccagacagcttataacctgcaactcatcttgatttgcag
CCAAACTGATTATCCACCAGACACTCAGCGTCTTAGAAGATATTGTGGAGAATATCTCGG
GGGAGTCCACCAAGTCTCGACAGATTTGCTACCAGTCGCTGCAGGAATCTGTTCAGGTCT
CCCTGGCCCTCTTTCCAGCTTTTATCCATCAGTCAG
gtaggagctggcccagaggccccactggtgggtggtgctaacaagggccagaatacccac
ttagatctgtagaacacactgagtcggtgcagtacaggccttgacttgttccgtgcaacg
aaacccggtactgaggggaaagggcagtgatgtttatttgtggagtctagggccaaggcc

Exon 30 +     106668     106782   1   Internal    115    74        Good
gcatgtccctaatcgttttccactttccatcattggccctgatggtgttggggaaatgtt
tccagcaggaagctgtagagaaagctgatagtgcagatttcaggagtaggttgatgaagc
ccagggttctggttctcactgtgtgcaagcctctgacgatatctctgcccctttcctcag
ATGTGACTGATGAGATGCTGAGCTTCTTCCTCACTCTGTTTCGAGGCCTTAGAGTACAGA
TGGGTGTGCCTTTCACTGAGCAAATCATACAGACTTTCCTCAACATGTTTACCAG
gtaagcacagacccaccatctatagttttcagattcaagggagaagtggtgggtctggcg
acaaagtgtggctttttgctcctgttctgcacttgccacagcatgggttttcatgctggc
ccccagagaaacatgtggttgctcactgtgtggctttctcctctgtagagagcagttagc

Exon 31 +     106951     107122   2   Internal    172   100   Excellent
catgtttaccaggtaagcacagacccaccatctatagttttcagattcaagggagaagtg
gtgggtctggcgacaaagtgtggctttttgctcctgttctgcacttgccacagcatgggt
tttcatgctggcccccagagaaacatgtggttgctcactgtgtggctttctcctctgtag
AGAGCAGTTAGCCGAGAGCATCCTCCACGAGGGCAGCACAGGCTGCCGGGTGGTGGAGAA
GTTTCTGAAGATCCTGCAGGTGGTGGTCCAGGAGCCAGGCCAGGTGTTCAAGCCCTTCCT
CCCCAGCATCATCGCCCTGTGCATGGAGCAAGTGTATCCCATCATTGCCGAG
gtaggggctcagacggtcccctgtgcagcaccccccatctccagattgggaagggaatga
gatttcacagaaaatgtattgtgttttaaagttcatttgttagtttaatatgcttgtaaa
gtagtttctcccaaggaagaaggcctttagtggtgtggtacagtgtttttatattgattg

Exon 32 +     108458     108619   0   Internal    162    95   Excellent
caggcagtgacaggactccaggggctggatgtcttttgcgcaggtagtgacaggcatgtg
gatggagtgttgacactcggcttgctgtcacgaggcgtctcctaggcatctttgctgccc
tgggcccaggccggagcagctccgcaagctgcaggtctgagcgtctgtgtgtctttgcag
CGTCCCTCCCCTGATGTGAAGGCCGAGCTGTTTGAGCTCCTTTTCCGGACGCTCCATCAC
AACTGGAGGTACTTCTTCAAGTCCACCGTGCTGGCCAGTGTCCAGAGGGGGATCGCTGAG
GAGCAGATGGAGAATGAGCCCCAGTTCAGTGCCATCATGCAG
gtaacgtgggggcggggttgctgccaggtgacttcctctaacctgaccactgcagcgagt
cctgtcttcgaagccccacagtctcgggtctgaagctcagttctgcctgttagtattgat
gaagttaattaatttcttggagcctcagtttcttcatctgcaaagtggagctaatgttgc

Exon 33 +     111220     111318   0   Internal     99   100   Excellent
cccggtggggaaaacatgaactctgagacttaggaggagcgtcgtagaggtctgagctgg
tgggccagaagcatcaagacaatgggtaccctggccctggcacttgttcttctgacatgg
ggtagatgctccagaagtgcttggtcttgcagtttataaaatggtggtctcatttcctag
GCTTTCGGACAGTCCTTTCTCCAGCCCGACATCCACCTTTTTAAACAAAATCTCTTCTAC
TTGGAGACTCTCAACACCAAGCAGAAGCTGTACCACAAG
gtaagtgccccagctcttggaaatattcttccatcaggggcattgtggcctgtgtcccac
cctcaggttactcactggagagtgtgacagaaagtggatgggacccgggacaggcccctg
ggggctggctgctgctcacctggtctctctgcctgcagaagatcttccggactgccatgc

Exon 34 +     111477     111707   0   Internal    231    99   Excellent
caagcagaagctgtaccacaaggtaagtgccccagctcttggaaatattcttccatcagg
ggcattgtggcctgtgtcccaccctcaggttactcactggagagtgtgacagaaagtgga
tgggacccgggacaggcccctgggggctggctgctgctcacctggtctctctgcctgcag
AAGATCTTCCGGACTGCCATGCTGTTCCAGTTTGTGAACGTGCTGCTCCAGGTCCTGGTC
CACAAGTCCCATGATCTTCTGCAGGAGGAGATTGGCATCGCCATCTACAACATGGCCTCA
GTCGACTTTGATGGCTTCTTTGCCGCCTTCCTCCCAGAGTTCCTGACCAGCTGTGATGGT
GTGGATGCCAACCAGAAAAGTGTGCTGGGGCGGAATTTCAAGATGGATCGG
gtgaggagagaaagaggccgggctaagaggagggcagagtgggcacgcaagcctggcacc
tgtgcagcaaggagggggcacattgaggcctctgggcgtggtctgtgcccaccctgcagc
ttggcggcagctcacgagatgcctgctgacctggtgctgtagcctgattgaggggcacag

Exon 35 +     114526     114627   0   Terminal    102    76        Good
ctcccacagcgcctggcacagagtctctgtgacacgcagtgcaacagtgaatagaagttt
tgagttttagaaagtgctcccctatcttcagtgcacactctgggatggaagtagctgttg
gggtctggtgggtgggtgacctggtgtgttgttggctgcagctatgcccctgccttccag
GACCTGCCCTCATTCACCCAGAATGTGCACAGGCTGGTCAACGACCTGCGCTACTACAGA
CTCTGCAACGACAGCCTGCCCCCTGGCACTGTGAAGCTCTAG
gcctgctactgcctggggacacggacttctgctgctgccacctgcgccagccctaccttc
caccacagatgtctcccagatgggccttggtcacactccttggcttctcccaccgcaagc
aacgctgcctgcctctgccgctcctccacatcttgccgctgcccagcagagctggcttct

--------------------------------------------------------------------------------