--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (42520 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (41 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        295        668   1   Internal    374    50    Marginal
aacccagcccctgcggaccgcaatctttgggaaaaaggcgcaaggtgggaacgcagggcc
gcacgtgggaaccgttcgcggctgccgggtttgcagcccctgcccgcgcagctgggagcc
gcaggaggcggcccgggactccagcctgcagcccctatcccgcctcctcccacgctccag
CCACGGCGCGGCGCTACCTGCTGCAGCCTCTCTTCTCCGGAGAGGCCCGGGCTCCTCCCT
ACACCCCCGCGGCCCAGCCCCGGGTCCCAGGCTCCGGCTCCGGGTCAGCATCCTCGCGCT
CAAGGCGGTCATGCCGGACTCCTGCGGACTACACATCCCGGCGGCCCATGCGGCCCCGTC
ACGTGATGCAAGGATCGCCGGCCTTTCCGCCAGAGGGCGGCACAGAACTACAACTCCCAG
CAAGCTCCCAAGGCGGCCCTCCGCGCAATGCCGCTACCGGAAGTGCGGGTCGCGCTTCCG
GCGGCGTCCCGGGGCCAGGGGGGTGCGCCTTTCTCCGCGTCGGGGCGGCCCGGAGCGCGG
TGGCGCGGCGCGGG
gtaagtggcggtccccacggggcaagtggcggtccccacggggcagcggcctagagaggc
ggaccccgcagtgtccgggtcccgggccctcacccgcgcccactgcaacccgactccgga
gctccgagcatcccttagttttaagtcatggcgggtgcgaacgggtctctgctgcaggcg

Exon  2 +       1219       1356   0    Initial    138    87        Good
tcagctgggctgtagttgagttctcccagggagtgtgggaggaaaggttatgcccaccag
agacccagggtcctgacggctggaggtccgcagtggggaaggtgggcagaggtgttgctc
agatgtccccattcctgtttcgtttgcacagaggggttttctggtgcgtcctggtccacc
ATGGCCAAACCAACAAGCAAAGATTCAGGCTTGAAGGAGAAGTTTAAGATTCTGTTGGGA
CTGGGAACACCGAGGCCAAATCCCAGGTCTGCAGAGGGTAAACAGACGGAGTTTATCATC
ACCGCGGAAATACTGAGA
gtgagtgagctacctgtgtctttgctaggctagagggaaatgcagagaaggctgggtttg
gtcttgcaccaggttctgtgggagacgggttgctggcaactgtctacacaggaatgctgt
ctccagtacttggaggccgacatgtccttcctcaggagacttcgaaagtcaggatcttgg

Exon  3 +       3003       3089   0   Internal     87   100   Excellent
gtgcagggattacaggcctgagccaccgcggctcgtcaagtgaatcttgattccagaaag
atctgttttaagtctctagtctggaaaatgcagtgggagtctttaggtggtttgtgactt
gcagttaaggagaccgtggcctgagcactggcccctttttcttctttcatctctctccag
GAACTGAGCATGGAATGTGGCCTCAACAATCGCATCCGGATGATAGGGCAGATTTGTGAA
GTCGCAAAAACCAAGAAATTTGAAGAG
gtaggtttatccagttgagctactagagagaggcacgtagactattcagagcctgagttt
gctttttttaggaacatggttgacagctgactgccgatgatctggtttgcactttttttt
tttttttttttttgagatggagtcttgctctgtcgcccaggctggcacaatcttggctca

Exon  4 +       6899       7043   0   Internal    145    98   Excellent
gcatccggccccctgccctgtacaatgctgatgctgcagacctgtctcttgcagggcgcc
tctgtgggaaggagaggggtccagggctggagtccgggtgcccctgcacttcagggactt
cttggcagccgtgtgggcgacgctggcaggctctgctgatcctgtggcttttgtctttag
GGCGAGCGTTTGGGGGTCCTCAGAGCCCTCTTCTTTAAGGTCATCAAGGATTACCCTTCC
AACGAAGACCTTCACGAAAGGCTGGAGGTTTTCAAGGCCCTCACAGACAATGGGAGACAC
ATCACCTACTTGGAGGAAGAGCTGG
gtgggtgccaccttgggttggaggtttctctggccttgacgatcaagtgtaacctggatg
ggaaggacctggggctggggaggggctgccgttctcagggatggcctgcagcgggtatgc
ccaccctgcttcatgcacctgggctcacctgcgtggccggagtgcccctgaggcacgtgt

Exon  5 +       8005       8117   1   Internal    113    99   Excellent
gccctgggctcccctgagcctcttcgggcccagtgcgtggtctgtctgttgctgccgggg
gactgatgatggggtttctggcagtgacgggtttggacacactgtcctgcggcgggaggg
ggaggtgagtgggagatgtagattcggcgtcctcgcaaactgccgccgcttctcccccag
CTGACTTTGTCCTGCAGTGGATGGATGTTGGCTTGTCCTCGGAATTCCTTCTGGTGCTGG
TGAACTTGGTCAAATTCAATAGCTGTTACCTCGACGAGTACATCGCAAGGATG
gttcagtaagaaaagaattgagatcctgttctgataatggtcctaagttcagctccgcag
tgaataaagttgaaaccaccaaaaaaatagaggttgggctgggcacaatggctcacgcct
gtaatctcagcactttgggaggccgaggcaggcggatcacgaggtcaggagttcgagacc

Exon  6 +       8591       8671   0    Initial     81    64    Marginal
ttgaaaccggaaggcagaggttgcagtgagcggagatcgtgccactgcactccagcctgg
gtgaaagagcaaaactccatctcaaaaaaaaaaaaaaaaaaagagaagtacgtagctatc
ttctgtttagctctcatctgatgtcttggttatctttttgttgtttgtttagaatgttgc
ATGAGCTCTGTCTCACTCATGCTGAACACCCAGCACCGAGAGCAGTGGCTGGCGCACAGC
AGGCACCTGAGTGCTTGTTGG
gtgggtgggacccccagggaggatgagccatgcgtgttattgacgtcatagagtgactag
accacagcccgtggtggctcggccatccaggcagtgctgccgggactgagctcggtgctc
cctgcaggatgatctgtctgctgtgcgtccggaccgcgtcctctgtggacatagaggtca

Exon  7 +       8800       8847   0    Initial     48    61    Marginal
ccagcaccgagagcagtggctggcgcacagcaggcacctgagtgcttgttgggtgggtgg
gacccccagggaggatgagccatgcgtgttattgacgtcatagagtgactagaccacagc
ccgtggtggctcggccatccaggcagtgctgccgggactgagctcggtgctccctgcagg
ATGATCTGTCTGCTGTGCGTCCGGACCGCGTCCTCTGTGGACATAGAG
gtcagtgcctcccctccccagggccggcccatttcaccctggtttctgggaggctggggc
ttgggggttgagccctgtgtgccacctgctggctgtgtagccctgggcaagctgctcggt
ctctctgagcctcaggagtcccccatgtaagtcaggatagccgggcgcctccatgtggag

Exon  8 +       9247       9372   0   Internal    126   100   Excellent
tgacagggacgtcaggtgcttcccacatgcccgcttgccctgtggcttggagagagggtg
ccatggcagcggggagaggtggcagcgcaggctgaaggaggtgggaaggaagcctgggtg
tcctctcctgtggggaggagctggggtaggacgggcgtgagccgtctccctctccaccag
GTCTCCCTGCAGGTGCTGGACGCCGTGGTCTGCTACAACTGCCTGCCGGCTGAGAGCCTC
CCGCTGTTCATCGTTACCCTCTGTCGCACCATCAACGTCAAGGAGCTCTGCGAGCCTTGC
TGGAAG
gtggggtttctgaaactgctctggaaggttcctgagagcacatggatgggacaagggcca
tcctgtctcccatgaatggttgtctgattcttggggtggccagacaatggcctgttgagg
gacggccagtgtcattttcccaggcagttgagctgaggtcagggttttggtggcattttg

Exon  9 +       9708       9781   0   Internal     74    89        Good
aggtcagggttttggtggcattttgagaaccctgctgcctctgtctttgggaggagatgg
tggcgagctggccggaccttgggtggctatagggcagcagccaggcggggccagcagcgg
gactggggctgggggcagggcttatgcctgccagcccctgacacgcattgtgtctcgcag
CTGATGCGGAACCTCCTTGGCACCCACCTGGGCCACAGCGCCATCTACAACATGTGCCAC
CTCATGGAGGACAG
gtgagtgtggtgggtggggcgcagggcagtggaggccagcacagccctcggggcagctcc
agtgtcccttgccaagcacacactggcttagagagtccttgtcctctcgggcagctgttc
cagaggctgccactagagcgaggcccatgacttctaggatccagcccctgtcctctcctt

Exon 10 +      11440      11476   0   Internal     37    82        Good
gctgcaggagcctcggcaacctcacacatccatggcggaccctgggacagggccctgctc
acattccgtctctctggggaacacttttagagcctacatggaggacgcgcccctgctgag
aggagccgtgttttttgtgggcatggctctctggggagcccaccggctctattctctcag
GAACTCGCCGACATCTGTGTTGCCATCATTTTACCAG
gtaaggcggtttctgtgtgcagtgagctggcaggaacgggagagctcccctcacgcctgc
ccacccatcccactgggggtcctgctgcgggggctgcggtggcatttctaggcctttcca
ggcagttgctttgcagctgggggtgaggtttggggccctttgtaggctttagtctttttt

Exon 11 +      13276      13419   0   Internal    144   100   Excellent
gctggagcatgtagaaacccctcctgggcgccccacctgctgtttctgcggcccctgata
aacgtgtggtgggcactgcgggctcaggcgtgctactctcggtcccaagggtgactggga
gggcgtcccacagcaagcaagcagctctgaccctgtgtgctggccgggctcgtgttccag
GCCATGGCATGTCCGAACGAGGTGGTGTCCTATGAGATCGTCCTGTCCATCACCAGGCTC
ATCAAGAAGTATAGGAAGGAGCTCCAGGTGGTGGCGTGGGACATTCTGCTGAACATCATC
GAACGGCTCCTTCAGCAGCTCCAG
gtggggtgggggcaggagctccggggagcaccgggaacccagacaggcaggctcggccca
ctcagaagatggtaccttgggccccatctctgggggtcccgcagagactgccagaaccgt
gttctctggtgattcgcagtggcgctcatccaccttccaccggagacaggtctgattttt

Exon 12 +      14477      14614   0   Internal    138    99   Excellent
gtctcaacccatgaggcccggagcggcctcagagggctgggggcgtctgtccccatgcgg
cccagagcggcctgagagggctgagggcgtctccatgcggtgggtgtgtagcgaggcctc
tggtgccaagtccatgtggggagtggaagtcagcctgtgtcatcgtgcctggtactgcag
ACCTTGGACAGCCCGGAGCTCAGGACCATCGTCCATGACCTGTTGACCACGGTGGAGGAG
CTGTGTGACCAGAACGAGTTCCACGGGTCTCAGGAGAGATACTTTGAACTGGTGGAGAGA
TGTGCGGACCAGAGGCCT
gtgagaccccctcctgggtggggcctttgggctttggctggtggggaggggccgggtgct
gggtgaagtgcagctttctgagcctcagaagccaagggccaggtgggcgcctgctttcca
ggtttctgcactcggcagggaaggctggcaggcacagcacgtgtttggtaacaagctcgg

Exon 13 +      15103      15206   0   Internal    104   100   Excellent
tccatgggtttggacacaagtcttccccgctgccaggagtgcctttgtgtctgggctgtg
ggctgcaggctgtgaggcggctgggctctgacagcaaaccagcctctcgaccagcagccc
agtgtggagaaggagagcgccggaggggcagaggggcaacaccggctcttcttttgacag
GAGTCCTCCCTCCTGAACCTGATCTCCTATAGAGCGCAGTCCATCCACCCGGCCAAGGAC
GGCTGGATTCAGAACCTGCAGGCGCTGATGGAGAGATTCTTCAG
gtagggggtcctctgtagccttgcctggcacctggagcctggccctgtctctgtctgggg
cccacccgggctgggtctcaggatgcccgatgagcagggccctcccctctgcctctggag
agccctggctctgggtgagcaggtgctagcttgctttccagtccagcaggacaggtcctc

Exon 14 +      15578      15659   2   Internal     82    99   Excellent
ctgggctccctcttttcgggggtcgtctggagagatgctccctgggaagcagagctctgt
gccctgtgtgcctggccgcgggaggacccagagtcgggctggcctgcgccaggcagacgg
gctggtgtggggctgtggccgggcactccccacccgccccagcaggctgccgtcccgcag
GAGCGAGTCCCGAGGCGCCGTGCGCATCAAGGTGCTGGACGTGCTGTCCTTTGTGCTGCT
CATCAACAGGCAGTTCTATGAG
gtgcgtgtccaggcggccgcagctgggggctcagggctatttctccgtgggcgggctgtc
tctgttgtgcacgtgctcccgcagagccgggctctgcctgggacttcggtcctgccggac
cctctgcagcccccagcgtggtctgtttacccctgttcattcactggcttgctcgtcctg

Exon 15 +      16878      17066   0   Terminal    189   100   Excellent
ggaaggggccccggggtctctgagtcgcgctcagcgggtgcttgtgctctctgcccagct
gtgctgaagtcccgagggacatgtccgctgcttgcgggtcggttcctgaggaattggaag
tgtcacgagatgtggccctcgttgggctggcgctcattggcctcccttgtgcctgtgcag
GAGGAGCTGATTAACTCAGTGGTCATCTCGCAGCTCTCCCACATCCCCGAGGATAAAGAC
CACCAGGTCCGAAAGCTGGCCACCCAGTTGCTGGTGGACCTGGCAGAGGGCTGCCACACA
CACCACTTCAACAGCCTGCTGGACATCATCGAGAAGGTGAGAGCCGTTGTACCCGGGGCC
GGGTGCTAG
cgtgccagagctccgtgggcagcaatggcctctgggccctctgtcctcctcttcgagtga
ccggatggctgtgtccgtaggtgaggctcccctccctgcagggtgggtgtcccgaggcct
gtgcagggcctgccactgctggatttgtgtcctgactgaaagtcctggacatgggtgtcc

Exon 16 +      18128      18241   0    Initial    114    87        Good
ggcggagcttgtagtgagctgagattgtgccaccgcactccagcctgggcgacagagcaa
gactcgatctcaaaaaaaaaaaaaaaaaaaaaaaaggtgtttgtggtagaaagtgttctc
acggctgctgactcagaaccatgagcctgtgtgtaagtcctggccttctcttcaaaggtg
ATGGCCCGCTCCCTCTCCCCACCCCCGGAGCTGGAAGAAAGGGATGTGGCCGCATACTCG
GCCTCCTTGGAGGATGTGAAGACAGCCGTCCTGGGGCTTCTGGTCATCCTTCAG
gtgggtgttctgcacgaggcctctgctcccggggcgcgcatggctagcgtccaccagctg
catctgcgttgtgttggagtctgttccccagcgggacccacaccctccctggatttgctg
agggtgcggtggtctcagcaggcagcagaaccttcctcctgctcttgtggagggatggat

Exon 17 +      23066      23188   0   Internal    123    97   Excellent
tgggttttactttttgctgctgtggagagagagtcctggtggtcctgggtttgaaggtcg
tgtgttttgaagcacgcactctagagcagccgccccggcccctgctccgggacaagggtg
ctgtcttaggactgcgttttcacctcctgcgccgtggtgagctgcgtcctctctctgcag
ACCAAGCTGTACACCCTGCCTGCAAGCCACGCCACGCGTGTGTATGAGATGCTGGTCAGC
CACATTCAGCTCCACTACAAGCACAGCTACACCCTGCCAATCGCGAGCAGCATCCGGCTG
CAG
gtatggtggctggggttgcgcagccagttcctgggggcccagccaggtatccccgtctcg
gcaggtgtggttcctggaagctgcagagacggccccaggatggggcctcagctgaccgtc
cctcctctgcacccactgtggccgcagcctccccagtcctggtgtccttccctctgcctg

Exon 18 +      24120      24265   0   Internal    146    92   Excellent
gggcctccggtgtcaccaggacagagcctgtgtctgtgttgggatgtgggtgtgtgcaca
tcagcaggtggccttttctgagtgcctgtggtgctggacgtgggtctgagcaggtgggac
gccgcctgtcctgggcctgcacgagcttggctctggctttcaccatcctcttcctgacag
GCCTTTGACTTCCTGTTGCTGCTGCGGGCCGACTCACTGCACCGCCTGGGCCTGCCCAAC
AAGGATGGAGTCGTGCGGTTCAGCCCCTACTGCGTCTGCGACTACATGTACGCGGGACCT
CGCCCACGGCCCATGAGGCTCAGGGC
gtcagaggcgctggggctgtggtggcgctgtttgcatgtctgagggatgtcccagggttg
ggaagagccaagtctgttccgttcctgctgcggggacttggcctcagctgcttctcttgc
ttctgcagggagccagagagaggctctgagaagaagaccagcggccccctttctcctccc

Exon 19 +      24474      24544   1   Internal     71   100   Excellent
tgtttgcatgtctgagggatgtcccagggttgggaagagccaagtctgttccgttcctgc
tgcggggacttggcctcagctgcttctcttgcttctgcagggagccagagagaggctctg
agaagaagaccagcggccccctttctcctcccacagggcctcctggcccggcgcctgcag
GCCCCGCCGTGCGGCTGGGGTCCGTGCCCTACTCCCTGCTCTTCCGCGTCCTGCTGCAGT
GCTTGAAGCAG
gtgagtggggccgggcagggaccatccgtcccacgttgggccaggaggacagggagctgc
cacctgcctgctgggcctccctccctgtctggcctgtggagggcagccctccctcagagc
tgagccttcccccttccccgagcagctgcagggacagaggcctgcgctgggcaggctccc

Exon 20 +      24851      24973   0   Internal    123    81        Good
ttcccccttccccgagcagctgcagggacagaggcctgcgctgggcaggctcccccggct
gagaacagggctccatagcccttgacgctgtgcagccacaaagcagagcctcagatgcta
gcttccgcctctgtctctagggtccagaaggccctgtcctgacgcctcctctcctcgcag
GAGTCTGACTGGAAGGTGCTGAAGCTGGTTCTGGGCAGGCTGCCTGAGTCCCTGCGCTAT
AAAGTGCTCATCTTTACTTCCCCTTGCAGTGTGGACCAGCTGTGCTCTGCTCTCTGCTCC
ATG
gtaccatggccggcctggggttggggtgggggacccagtagggtttttccccaaaagact
gcgagcctctgggcagagcgagtgagacccttcgggctcgggctccatttccctcaaact
cagctgcactctggagcgcagattgtgccttgggcagggtggagggacccctgccccagc

Exon 21 +      25438      25593   0    Initial    156    48    Marginal
cacctcacattcctggtgtgttacttggcaggcactcccaccactccgaaagggaggccc
ttcctgggagggaggcaagaaggctccccagcccctttgccccctttcctgggcctgcgt
tcccagggcctccccagcccctctggctaccccgtgacctggccgctggggagaggtttc
ATGCCTGGATTTGGTCATCAGCTTTCAGGCCCAAAGACACTGGAGCGGCTCCGAGGCGCC
CCAGAAGGCTTCTCCAGAACTGACTTGCACCTGGCCGTGGTTCCAGTGCTGACAGCATTA
ATCTCTTACCATAACTACCTGGACAAAACCAAACAG
gtaggaggtcagagcaggacaggcgagcttgatggggcctgggattcgagggcctggccc
aggtaggccccacatttttctcataaacgagtttctgccaggccagggatgagtgagttg
gctctgcttccctgggtggctgccagatgcccagagtggggacatccgattccctggtgc

Exon 22 +      26810      26999   0   Internal    190    95   Excellent
agcagtctgctgtgcagagtctgctcgggtagctcagcactgctggctctgccccacagg
cattcagggacttgctaagcctcggctgttctcccggtggagcactcgaggttggcgagg
ggtaggcgaggctgcctctgctgcaagcgggtggggcctgaggtgtcctgtctcctgcag
CGCGAGATGGTCTACTGCCTGGAGCAGGGCCTCATCCACCGCTGTGCCAGCCAGTGCGTC
GTGGCCTTGTCCATCTGCAGCGTGGAGATGCCTGACATCATCATCAAGGCGCTGCCTGTT
CTGGTGGTGAAGCTCACGCACATCTCAGCCACAGCCAGCATGGCCGTCCCACTGCTGGAG
TTCCTGTCCA
gtgagtccccgccctgcctgcgcatgcacccgagaggttcgggctgtgtaacctgtgcgg
gcttctctggtgccctctctcaggactccttggggaacctgggtgtctcgccttctgctg
cctcagggcctgggcgtctctgcccggctgccatgagtgctctccttcctggctttgagg

Exon 23 +      28409      28502   1   Internal     94    94   Excellent
gtggttggctggccatgggaccgagagttgaggccagggtcgggaaagccacgtccgtgt
ggccgtggccttctctcctctgcagcaccccatcgctgccgtgggcagagcagccgtgtt
ggccttcagaggcgctgcacgggaccccggctcccctgaccaccctctccattaccgcag
CTCTGGCCAGGCTGCCGCACCTCTACAGGAACTTTGCCGCGGAGCAGTATGCCAGTGTGT
TCGCCATCTCCCTGCCGTACACCAACCCCTCCAA
gtgagtggtcgccccaggccctgtgcctcccagccgtggcccccgctaggccttgcggca
gaaagccccggcagcctttgtccccaaggcctgagcgcctcggttttttgcacttcatgc
cctggggatgtttccctgctgccaggatggagtgccagcccccttctcatctcaggttta

Exon 24 +      28678      28780   2   Internal    103    96   Excellent
tccaagtgagtggtcgccccaggccctgtgcctcccagccgtggcccccgctaggccttg
cggcagaaagccccggcagcctttgtccccaaggcctgagcgcctcggttttttgcactt
catgccctggggatgtttccctgctgccaggatggagtgccagcccccttctcatctcag
GTTTAATCAGTACATCGTGTGTCTGGCCCATCACGTCATAGCCATGTGGTTCATCAGGTG
CCGCCTGCCCTTCCGGAAGGATTTTGTCCCTTTCATCACTAAG
gtgggctcagggccggtgaaggctgtgtctctcggtaggccagggcttgctttgcccttg
gctgtccatggtcgggcagagtgacaggcaggtggagggcagtgggagggtgtttggggc
tgtgcctgtggcgctgggggctctgctgggcagcctgcagggctttgatgcgcggcaggc

Exon 25 +      29101      29210   0   Internal    110    90   Excellent
ctctgctgggcagcctgcagggctttgatgcgcggcaggcattgaggggtgggagctggg
tgccgccgccttgcccctagcctgcagcttgtccctggccagggggcacccggcaggcct
ggtgagggcctccagcccccattgccacccctcactgtctgggtgtgctcactctgccag
GGCCTGCGGTCCAATGTCCTCTTGTCTTTTGATGACACCCCCGAGAAGGACAGCTTCAGG
GCCCGGAGTACTAGTCTCAACGAGAGACCCAAGAGGTACGGCCTGCGGGG
gtgtgcctggagtcggtgtggggtggggaaggacatggggctgtggcctgcctgacggtg
cctccaagtcagtgagtggaaatgggtcctgtgtgccctggagtatgtgaggcagggcag
gacctgcaagggccgctaacacccctcagcccctcagcaggttggccgtggtggcctggg

Exon 26 +      31642      31806   2   Internal    165    81        Good
tctgggacaatgtggtccacgtgattctcaagctgaggctcgctgggccgcccacgccct
gttggggtctttccgagcgaggtcctcagccgtgcatgcgttgagctttggcccttggtg
ataggtggctcggcccgccctacctggcaccctgaccctggtcacggcctctccctccag
CAGGATACAGACGTCCCTCACCAGTGCCAGCTTGGGGTCTGCAGATGAGAACTCCGTGGC
CCAGGCTGACGATAGCCTGAAAAACCTCCACCTGGAGCTCACGGAAACCTGTCTGGACAT
GATGGCTCGATACGTCTTCTCCAACTTCACGGCTGTCCCGAAGAG
gtccaggcggcactacagggctgggcgggcctgcgggagctccacgggcaagctgggttt
cacgctccctgtcttctaggtctcctgtgggcgagttcctcctagcgggtggcaggacca
aaacctggctggttgggaacaagcttgtcactgtgacgacaagcgtgggaaccgggaccc

Exon 27 +      32167      32279   2   Internal    113    74        Good
ggtcgttactaggcctggactcgggggagctgcagtccggcccggagtcgaggtgactgc
accttcctttcctccgcgcctgccagcctcgacaccggctgtcccgagcccaggcccacg
tggcaccctcgtaccagcctggggactaagtccaccctgtgcgtgggattctcttctcag
CTCCAGCCCCGGGGTGCATGTGAGACAGACCAAGGAGGCGCCGGCCAAGCTGGAGTCCCA
GGCTGGGCAGCAGGTGTCCCGTGGGGCCCGGGATCGGGTCCGTTCCATGTCGG
gtgagccttggccccagccacctccacacaggcaccggggctccctcagttgctgctggt
cccagtgttcaggaaggccccgagcccaggggccggggtggctggcttcaggcccggccc
acgtcctgactctggggtgagccttccacagctcaccccagagccgtggagtggtggagt

Exon 28 +      32775      32987   1   Internal    213    79        Good
ctgtggccctgggttcactgaggccagcactgtggtgggccgtgccccaagggcagagct
gccaccgtctctggctgcctgtggcactagcttgccaggctcggggggagcattcagctt
gaggctggtggttttgcatcaggtaagtggtggtcaccagtcctctgccctcttcttcag
GGGGCCATGGTCTTCGAGTTGGCGCCCTGGACGTGCCGGCCTCCCAGTTCCTGGGCAGTG
CCACTTCTCCAGGACCACGGACTGCACCAGCCGCGAAACCTGAGAAGGCCTCAGCTGGCA
CCCGGGTTCCTGTGCAGGAGAAGACGAACCTGGCGGCCTATGTGCCCCTGCTGACCCAGG
GCTGGGCGGAGATCCTGGTCCGGAGGCCCACAG
gtactgggcggggctggcctgagcgccatctttctgccagtcacccacagagctgtggac
actcaggggcgattgcagacttggccctcttgggatatttgggggtaacttttgtttttt
ttttgagacagagtcttgctctgtggcccacgctggaacgcagtggcgcaatctcggctc

Exon 29 +      34205      34408   1   Internal    204    98   Excellent
tgagcggggcagcagggtgggtggccgtcagagcagcgctggctccgacatcgtggtcct
gaggattgtgggagggagcatgagggcaaaaccagggcccaggccaggaggcccctgggg
ggccagagatgggtaaggggaggtactggcctcaggccaaaggtgctgccgcctccgcag
GGAACACCAGCTGGCTGATGAGCCTGGAGAACCCGCTCAGCCCTTTCTCCTCGGACATCA
ACAACATGCCCCTGCAGGAGCTGTCTAACGCCCTCATGGCGGCTGAGCGCTTCAAGGAGC
ACCGGGACACAGCCCTGTACAAGTCACTGTCGGTGCCGGCAGCCAGCACGGCCAAACCCC
CTCCTCTGCCTCGCTCCAACACAG
gtgagtggcatggcgggccttggcacgggctctgctcccactggcctggtgctcccggtg
acggcaatgtggctcctctctgctgagggcgcccacacggctgggagtggtccctggcct
gcctcagcaccattgttctccggtgtttgggaggaggctgacccgtgggaggtgtctgcc

Exon 30 +      36305      36426   1   Internal    122    93   Excellent
gtgcaggccttcccagcgtcctccctgcccgctcggtggatggcagcagtaagcagagcc
ctggggaggctcgcagggctgctgtccctctggtcaggagaaggctggttctcggaggcc
acgtcagggccagggcctggcccagccccacatccagcagccccgtctgtgtcctcccag
ACTCCGCCGTGGTCATGGAGGAGGGAAGTCCGGGCGAGGTTCCTGTGCTGGTGGAGCCCC
CAGGGTTGGAGGACGTTGAGGCAGCGCTAGGCATGGACAGGCGCACGGATGCCTACAGCA
GG
gtgagtgtggctcagagcctggaccctgctgacctcggggggctccttaggggaggcagg
gctctgcgtgggtgtgcctgcaccctgggaactggctctgaacttgggggagatgttctt
ccacatccctcgtgcacagacggtctgcactttgcagccatccacctgggccggccctgg

Exon 31 +      36859      37071   0   Internal    213    84        Good
gtgctgctgcgtcaacgggcgggggccgtagcctggtgctcgggctggtctgtggccctg
ggatggaggacagatagggcctcaccacctccaggtcaaccccaggtgggctcgagggtg
cctgctgacaggggttctctttgggatggtcctttctagtcgtcctcagtctccagccag
GAGGAGAAGTCGCTCCACGCGGAGGAGCTGGTTGGCAGGGGCATCCCCATCGAGCGAGTC
GTCTCCTCGGAGGGTGGCCGGCCCTCTGTGGACCTCTCCTTCCAGCCCTCGCAGCCCCTG
AGCAAGTCCAGCTCCTCTCCCGAGCTGCAGACTCTGCAGGACATCCTCGGGGACCCTGGG
GACAAGGCCGACGTGGGCCGGCTGAGCCCTGAG
gttaaggcccggtcacagtcagggaccctggacggggaaagtgctgcctggtcggcctcg
ggcgaagacagtcggggccagcccgagggtcccttgccttccagctccccccgctcgccc
agtggcctccggccccgaggttacaccatctccgactcggccccatcacgcaggggcaag

Exon 32 +      37523      37636   0   Internal    114    88        Good
gggcggggctcctgacacctctcctgcgggaacctggtgcctcacttgccccaggccgag
cgggctggggtggggtcctcgcctgtgccctagggctggctggaacccctgggagggcgg
tggagtgggagatggccaggctctgtgttcctccctgtgggctgtggctgccctggccag
GCCCTCACCTGGGTGCCCACCATCCCCTCCCTGTGCAGTTTCGTGTTCCTGCAGCTCTAC
CATTCCCCCTTCTTTGGCGACGAGTCAAACAAGCCAATCCTGCTGCCCAATGAG
gtaggcgtggcctccctctcctgcatccgctggagctgtgtggctcgggtgaatggtggg
gggcccagctctgctgctgggagctcaggcttgcagagggctctggcctaagctccctgt
ggcagcctgccgtgaccggcctgggtggggcggcctcctgtggacgggcgtctggggctc

Exon 33 +      37867      37932   0   Internal     66    87        Good
gaatggtggggggcccagctctgctgctgggagctcaggcttgcagagggctctggccta
agctccctgtggcagcctgccgtgaccggcctgggtggggcggcctcctgtggacgggcg
tctggggctcaggcagggctctgtgtgccacagtcacagtcctttgagcggtcggtgcag
CTCCTCGACCAGATCCCATCATACGACACCCACAAGATCGCCGTCCTGTATGTTGGAGAA
GGCCAG
gtgaggctgcggggccggcctaggtgcctggacagggccagctgggcctcagcctgcagt
gggtagggagtctgggcccccaacgccccacagagctcaacactgccgggtcccctacag
catgaagtgctcattgagctctgtgccaggtgctgctctgagtgctggggaccccggtgc

Exon 34 +      38803      38989   0   Internal    187   100   Excellent
agagagggagtcaaggatgacacccgatgtctggcctgggtggctgctggaatggatggt
cttgtctgcctcagggatcagagtggggctcccggcagagcctgctgggcacccccaccc
tctgcggggcagggcccggcccgggagtgatgccaccctgcctctcccctctccccacag
AGCAACAGCGAGCTCGCCATCCTGTCCAATGAGCATGGCTCCTACAGGTACACGGAGTTC
CTGACGGGCCTGGGCCGGCTCATCGAGCTGAAGGACTGCCAGCCGGACAAGGTGTACCTG
GGAGGCCTGGACGTGTGTGGTGAGGACGGCCAGTTCACCTACTGCTGGCACGATGACATC
ATGCAAG
gtacggcctggcgcctacccgctcctgctgccccaggcctcagggcacggctcccatcca
gtcctgctaccccacgccctggggcatggccctggcacccccacctgctccagctcccca
cgcctcaggttccgagcctaacagcgtgggcatggaggcagtgatggggctggtggcttt

Exon 35 +      39342      39499   1   Internal    158   100   Excellent
gtggctttgcgtcccaaagccctgcccctggggagagccgaggaccactggccaggcacc
agaggacgtggtccccgcaggcccccagagcccctggagtaatcaggaggtgccccagtg
caaggcacagagggcctcagcactggccccacaaacccatccggccctgctcaccctcag
CCGTCTTCCACATCGCCACCCTGATGCCCACCAAGGACGTGGACAAGCACCGCTGCGACA
AGAAGCGCCACCTGGGCAACGACTTTGTGTCCATTGTCTACAATGACTCCGGTGAGGACT
TCAAGCTTGGCACCATCAAGGTGAGTGAGGGGCCGTCA
gtgaggctgggccccaggcaggtgcccactgctgtgtcccgggttggtggcaggtcctcc
tccctgagcttcggtcacgaggagcaggaggagaggccgcagtgctcagggccccgtggg
cacgagcttcaccccgagcctgcgttgtgtcctctgtgccctgaagcctgtggcgcctgc

Exon 36 +      40145      40218   0    Initial     74    67    Marginal
ggaggcctcactccaagggccccaggatgctgaggcagccactgaaccaaaaccccgggg
ctggtagtcagagtccaggaggggcaggagcatagggaggtgggctctgctagatgccaa
gacaaccagttgggggggggggggcacctgggcggctgaggagggtgtggtggtgccgag
ATGGGGTGCACGGCTCACTTCATGGCTGGGCAGACGGATTCGGACGTGTGGCTGCAGACA
CCCTGGGGGCCCCA
gtgagtggaggtgccccagcaattagaggtgtcttgcctgtggctgcagcatatgtgggt
gctgcgcccagatgtggagggggcttggcctgggggaggccagacaaacacagccccgct
gccagaggggaaagttcaggggcagatgctgcccatggagctgacaggtgtctagcagtg

Exon 37 +      40473      40551   0   Internal     79   100   Excellent
tggagggggcttggcctgggggaggccagacaaacacagccccgctgccagaggggaaag
ttcaggggcagatgctgcccatggagctgacaggtgtctagcagtgcaaccaggcagtag
ccgagatcagccttcagcacacgctgtgtgcggggatgaccctttctcttgtccgggcag
GGCCAGTTCAACTTTGTCCACGTGATCGTCACCCCGCTGGACTACGAGTGCAACCTGGTG
TCCCTGCAGTGCAGGAAAG
gtagggccgggtggggccctgcagtgcaggaaaggtagggccgggtggggccctgcagtg
tggcgccaagagccctgggcctggcgtgaccaccaagtctccccagacatggagggcctt
gtggacaccagcgtggccaagatcgtgtctgaccgcaacctgcccttcgtggcccgccag

Exon 38 +      40610      40749   1   Internal    140    99   Excellent
cacacgctgtgtgcggggatgaccctttctcttgtccgggcagggccagttcaactttgt
ccacgtgatcgtcaccccgctggactacgagtgcaacctggtgtccctgcagtgcaggaa
aggtagggccgggtggggccctgcagtgcaggaaaggtagggccgggtggggccctgcag
TGTGGCGCCAAGAGCCCTGGGCCTGGCGTGACCACCAAGTCTCCCCAGACATGGAGGGCC
TTGTGGACACCAGCGTGGCCAAGATCGTGTCTGACCGCAACCTGCCCTTCGTGGCCCGCC
AGATGGCCCTGCACGCAAAT
gtgagtgggggtgggtccaggcgtgagctggtgggacaggcccaggtgccacctgatagt
gagctcaccccctgcctacgtccccagatggcctcacaggtgcatcatagccgctccaac
cccaccgatatctacccctccaagtggattgcccggctccgccacatcaagcggctccgc

Exon 39 +      40658      40935   1   Internal    278    81        Good
gttcaactttgtccacgtgatcgtcaccccgctggactacgagtgcaacctggtgtccct
gcagtgcaggaaaggtagggccgggtggggccctgcagtgcaggaaaggtagggccgggt
ggggccctgcagtgtggcgccaagagccctgggcctggcgtgaccaccaagtctccccag
ACATGGAGGGCCTTGTGGACACCAGCGTGGCCAAGATCGTGTCTGACCGCAACCTGCCCT
TCGTGGCCCGCCAGATGGCCCTGCACGCAAATGTGAGTGGGGGTGGGTCCAGGCGTGAGC
TGGTGGGACAGGCCCAGGTGCCACCTGATAGTGAGCTCACCCCCTGCCTACGTCCCCAGA
TGGCCTCACAGGTGCATCATAGCCGCTCCAACCCCACCGATATCTACCCCTCCAAGTGGA
TTGCCCGGCTCCGCCACATCAAGCGGCTCCGCCAGCGG
gtagggaatatggggctccctcagcggggtgtgctggctgcccaagctgtggggcgggtg
tgtgggcagagcggttgccacgcctcccagacttactgcccaagccgcctctgccttcag
atctgcgaggaagccgcctactccaaccccagcctacctctggtgcaccctccgtcccat

Exon 40 +      41056      41214   0   Internal    159   100   Excellent
gatatctacccctccaagtggattgcccggctccgccacatcaagcggctccgccagcgg
gtagggaatatggggctccctcagcggggtgtgctggctgcccaagctgtggggcgggtg
tgtgggcagagcggttgccacgcctcccagacttactgcccaagccgcctctgccttcag
ATCTGCGAGGAAGCCGCCTACTCCAACCCCAGCCTACCTCTGGTGCACCCTCCGTCCCAT
AGCAAAGCCCCTGCACAGACTCCAGCCGAGCCCACACCTGGCTATGAGGTGGGCCAGCGG
AAGCGCCTCATCTCCTCGGTGGAGGACTTCACCGAGTTT
gtgtgaggccggggccctccctcctgcactggccttggacggtattgcctgtcagtgaaa
taaataaagtcctgaccccagtgcacagacatagaggcacagattgcagtcagacagctc
ttttattgactttgtctgcttggtgcgggggttgggggggtgtcgaggctctagaagcgg

Exon 41 +      41687      41796   0    Initial    110    63    Marginal
acagtcaccttcctccaccctgggagccagcccccaggaggagtcttttcctctaaccac
cctggggtcctctgacatgcctagtcctgctacttgcccagacctgatgccagcaggcct
gggcgctgctctcttgctacctggcctggggcaagggaggatgacaaggcctctggggtg
ATGAGAGTGCCTGGCAGACAGCTGTGCCCCCAGCACCGGCCCAAGGCCAAGCTCGCATCC
AAGCAGCAGCCGGGCTGCCATAACGCCACCACACCTACCAAGCGCAGCAG
gtgttgggggaggccagctctgggcgcaggcccctcagccctagtgaaaatagtgacata
caaaaatatacacattttaacaccatataaattactgacacgagacacacagtgagacgg
tgcagggagtacggtaggaactggagaggtaataacttaggggcagggtggcggcggtgc

--------------------------------------------------------------------------------