--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (57017 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (28 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1291       1352   0    Initial     62    45    Marginal
ggagcggcccgcagagccagtggccggcgggcgccccgcccccagcgagtagggacccgg
agccactgccgcgccgcagtccgggctccccgcgccgccgctcgctcacctgcgctcccg
cccgcccctcggtgcgcgcccggcccgccagccgccgccgcccgcaccccgagcgccacc
ATGAACTCGCTCTTCAGGAAGAGAAACAAAGGCAAATACAGCCCCACTGTGCAGACCCGG
AG
gtgaggaggcgcccacagctccgctccgggacgctcttgcccctgtgggcgcacaggacc
tggaagacctcccgggcagtgtaggaatggggggtacgggggtccaggaaccgggaactg
aacccggagtgcgggactctcgggaacgcgggaccgaggccaccctgaagctgggaagcg

Exon  2 +       7845       7904   0   Internal     60    96   Excellent
ctattctatggactccccttctccttggtagctcttatctcagcagctatgtgactccgg
ggtagccacatgtggctgtgtggctgccttcccccagacactggtgctacacgcgtgctg
aatgaatgaatgaatgagagtaagccatgggggactgctaagattctccccttccctcag
CATTTCAAGAGAGCATACATTGCCCTGCGCTTCACACCCCAGGACCAGCAGAGCCCGGAG

gtggggatgaatggggcaggggttccagctagtggaaaggagtgcgaggcctgagcaggc
tgccccctgccctgtccccatccagtcacctcctgcgtgcaggacggtgagcagagagtt
ggctgagtacacagctggcagcaatgcggagtgatagtgagataaaggagggccctgacc

Exon  3 +       8744       8794   0   Internal     51    63    Marginal
caaggctgcagtgagctgtgattgtgccactgcactccagcctgggcaacagagcaagac
cctgtctctaaataaataaaataaaacaggcttaggaagaaccagtaaatctaaaattct
gctactcctaagaaggggcctgaaaggataatgaacaataacatttctcttcctttttag
AAAAATCTGCAGCAAAGATGGTACTGTGAAAACATCAACCAAACCGTGGTG
gtggggacatgcgtggctgattcttttcagtacttttctgcatgtctgagtagatcacga
gttttccagtttaggtgaagggtggagtagagaaggcgagctggcgtggggcacagctgg
cggggggcacagcgtgggaagagcctgcaggcaagccctgagtcctgggtctcagagtcc

Exon  4 +      13102      13172   2   Internal     71    66    Marginal
gcacccagtaggtgccctcagtgttgttactattcatcagttatttcctgagtgtccacg
gtggttgcctttgtgtcagagccagggcagatgtttcaggagccaggcagtgtttaaaga
aggtaggggcagagggctactcggcaccggaggtgcacctcccccaagctggccctccag
GCAGGCAGGACGCCAGAAGAGGATGACCGTGGTGGCAGGAGGCCCAGCCCCTTCTCTGGG
CTCTGGGACAG
gtgaggctggttccagggaggggtgtaccctcctgtgcgttccagacattccagcagcaa
tgcaaccccaatacacacccactgagacagaattaacccccagaggaaggaactgcagat
gtgatcaaaggccagtggccctggccaggcagggagtgctgagcctgcagggacctgtgt

Exon  5 +      22850      22974   0   Internal    125    97   Excellent
ctagcatccccatgagtaacttctagcccagtcgatcacatgcctctggagtgagattgc
ttgcggggagaatcgcggttcaccagctgtgtgaccctgagcaagtgctttgatgtctca
gagtcttggtttcttcatccccttcttcaaaggggcacaccaacctccccggggacttag
GGCAAGGATGATATTGAGCTGGTGCCTGTGAATATGTCTGAGGTCTGGCAAAGCCCACAG
CAAGTGGCAAATGCCCAGGATGCCTTTGTGGTCATCGCCAGAGGACAGATGGAGAAGCGG
AGGCT
gtacgagggtagggcacttgcctgaggctgtctaagcagcaagcagcccagtgggccttg
ggcctggcctgtctgctcatagcttcctgctaccgctcacagctttgtcccatcaggagt
ccaaggtccctgaggcagtggtcattgccccacaactcccatgtcctctggggggcttcg

Exon  6 +      27387      27582   2   Internal    196   100   Excellent
cttgtctctgtggctttagtgatgttgccctatgggaacagcccaactacctcaaaggct
ctgtgggcagctcctgctcagagcgtggggccggggccagccagaggatggggtgctggt
ggggacatagcccccacccaccaggcaccccgcccatctcccctcggcttctgcccgcag
CATCTCTAACAAGGAGCTCTCGGAGCTGATCGAGCAGCTGCAGAAGAATGCCGACCAGGT
GGAGAAGAACATCGTGGACACAGAGGCCAAGATGCAGAGTGTGAGTGCCCCCACTCCCAC
TCCCACCTGGGTGCCCCGTGCTGCCAGCCCTGTTCAGGACCAGGATCTGTTTGGAATCGG
TGATTCTCACCCAGGG
gtgattgtggccccgagggaacatgcagagacattttggttgtcactgcttggaaggaag
gtcctcctggcgtccagttggggaggggagacagggatgctgctgaacaccctaccgtgc
actgtagggcaggggtgccaaggtcaggaagccctgctctgtgagaggaacctggccatt

Exon  7 +      34296      34450   0   Internal    155   100   Excellent
accacgtagcagcaaagagatggaactaccgactgcgctccatatggacaagcctggaag
acgttattcaaagggaaagaaggggagcaccctgctgacccctttcctcccacccctccc
attgccaccgtgcccgctctcggctcctgttcattgtcccctctcttgtgaccctcacag
GACCTGGCTCGGCTGCAGGAGGGTCGGCAGCCTGAGCACCGGGACGTGACCCTGCAGAAG
GTGTTGGACTCTGAGAAGCTGCTCTATGTGCTAGAGGCGGATGCGGCCATTGCCAAGCAC
ATGAAGCACCCACAGGGGGACATGATCGCCGAGGA
gtaggtcccttctgcttcttaccccaggggagccattgggggctatgggccagggcgggg
ggtcctgttcagcatttgggagcccgagtcaggggttatcaagggctaattaggtgccag
gcacgtgccaaaggcttcacatgatcctttcttttttttttttttgagacgtagttttgc

Exon  8 +      35810      35897   2   Internal     88    75        Good
aaaaaaaaaaaaaagtgcatgggaggaggggtgagaggatgctgtgattgtctggaaccc
aaggccatatggtcactgtgtccttccaggacactgaggccggggtctgggtggggggcc
cctcctggggtgcaggcagtgccaaccagccccactaagtgggagcctctctcccatcag
TATCCGCCAGCTGAAGGAGCGTGTGACCAACCTGCGCGGGAAACACAAGCAGATCTACAG
GCTGGCGGTGAAGGAAGTGGATCCACAG
gtcaactgggcggcactggtggaggagaagctggtatggcctggacggggccgctggctc
cagggtttcagctggggagggggctgtgcgtgtgcagggagagcctacccatgtaatggg
catcccgggtcttaccagggagacagtcgtggtcctgatggttttccagtgtgcccatga

Exon  9 +      37247      37372   0   Internal    126   100   Excellent
gtcagtgctcagcaaacagaacctcagggttgaaggtgtggccagcatctccttgtggct
ctgcagggccccgtgaaaaagagagcaccatcatgcccacccccgaggctcctggggtgg
ccacacgtccccagccctcagcccaccctctccttattgcttctctgccctcctggccag
GACAAGCTGAACAACCAGAGCTTTGGGACTGACCTGCCGCTGGTGGACCACCAAGTGGAG
GAGCATAACATCTTCCACAATGAGGTCAAGGCCATCGGGCCCCACCTGGCCAAGGACGGG
GACAAG
gtggggcgtgtgctggtgtggtggggacccagggatggagggggccgcgcctgcttcctg
gccctgacccatgccctcggctctgtcctcaggagcagaacagcgaactccgggccaagt
accagaaactgctggtgaggagctccctgggggaaaggcctcatggggagaggagaggat

Exon 10 +      37465      37506   0   Internal     42    98   Excellent
gctggtggaccaccaagtggaggagcataacatcttccacaatgaggtcaaggccatcgg
gccccacctggccaaggacggggacaaggtggggcgtgtgctggtgtggtggggacccag
ggatggagggggccgcgcctgcttcctggccctgacccatgccctcggctctgtcctcag
GAGCAGAACAGCGAACTCCGGGCCAAGTACCAGAAACTGCTG
gtgaggagctccctgggggaaaggcctcatggggagaggagaggatgggaagcttggagt
cggggggacaaggatgtattgttttaaaaatgacataggcagctgggcatggtggctcac
gcctagcactttgggaggcagaggcaggaggatcacttgagcccacgagtttgagaccaa

Exon 11 +      38994      39113   0   Internal    120   100   Excellent
ctgggcttgtcctcaggccacccatagctgggcttgtcctcaggccagccatagctgggc
cctgcaggaggtagggaaggaagcgagcagtggcagcgggctgaggacgcagccctttcc
ttgccccggccccttcaggcagcatcacaggcccggcagcagcacctgagttcgctgcag
GACTACATGCAGCGCTGCACCAATGAGCTGTACTGGCTGGACCAGCAGGCCAAGGGCCGC
ATGCAGTACGACTGGAGTGACCGCAACCTCGACTACCCCAGCCGCCGGCGCCAGTATGAG

gtgggttctgggggcctggggcatcagggaggaggcagccctggaaggagcacgggaccg
ccaggctgggcactgaggcccctccactgccccccactgcagaatttcatcaaccggaac
ctggaggccaaagaggagagaatcaacaaactgcacagcgagggcgaccagctgctggcg

Exon 12 +      39216      39323   0   Internal    108    91   Excellent
cagcaggccaagggccgcatgcagtacgactggagtgaccgcaacctcgactaccccagc
cgccggcgccagtatgaggtgggttctgggggcctggggcatcagggaggaggcagccct
ggaaggagcacgggaccgccaggctgggcactgaggcccctccactgccccccactgcag
AATTTCATCAACCGGAACCTGGAGGCCAAAGAGGAGAGAATCAACAAACTGCACAGCGAG
GGCGACCAGCTGCTGGCGGCCGAGCACCCCGGGAGGAACTCCATTGAG
gttcatgcaccccgagaccagacacctcccccagggtggcttctggttggccgctgcctg
tgggccgcctggagctcgggcagaccccggagctgggggtcctgcaagctgcatcttgtg
tctgtctgtctctttcttgctgtgtctgactctgcctcctccatttatcctgatccgttg

Exon 13 +      40566      40661   0   Internal     96    94   Excellent
tgacccctctctcctcctcccactcctgagcagaagctggctacccctgtggtagccaca
cccagacagatgccagatgcctccctcccccgccatgccccagcccaatatcccagcagt
ccctcccttggtgtctgcagtacctgcccagtggtgaccggccccttctcttcctggcag
GCGCACATGGAGGCTGTGCACGCAGACTGGAAGGAGTACCTGAACCTGCTCATCTGCGAG
GAGAGCCACCTCAAGTACATGGAGGACTACCACCAG
gtacttacctttcctgggagtccccccagcaccgggggtgctactctctgagagcgctca
gtgcctacctggctcatgtgtggcctcgtgctccttggtccaggagccttgcggggcagc
catcccaggcccccagcacccatgcttctgatggcgtgtgcagacatgtcccaagcttgc

Exon 14 +      40827      40909   0    Initial     83    61    Marginal
gaggactaccaccaggtacttacctttcctgggagtccccccagcaccgggggtgctact
ctctgagagcgctcagtgcctacctggctcatgtgtggcctcgtgctccttggtccagga
gccttgcggggcagccatcccaggcccccagcacccatgcttctgatggcgtgtgcagac
ATGTCCCAAGCTTGCCGGCCCCTGTCCAACTTCCCTGGGGACCAGGGCCAGAGTCTGATT
CCCCAGGTCACATGGGGCCCAGG
gtgagtgtgtagggttttaattttggtaaaatctataatatacatgcagatacataaaac
aaaatttgccttttttttttttttttttttttttgagagagtcttgccctgtcacccagg
ctggagtgcagtcgtgccatctcggctcactacaacctccacctcctgggttcaagtgat

Exon 15 +      42620      42742   0   Internal    123   100   Excellent
ctcagggagggtggggctgtctccacgcagaggagcctcaggctcagcacagggtcccat
gctggactccaggtgaaccggaggcccagccccgcctgagggatgagcttgaagcctccg
acagaagcccaggtgcttctagtggtttcctggctgtaacagagccaccttctcccctag
TTTCACGAAGACGTGAAGGACGCTCAGGAGCTGCTGCGCAAGGTGGACTCGGACCTGAAC
CAGAAGTATGGCCCTGACTTCAAGGACCGGTACCAGATTGAGCTGCTGCTGCGGGAGCTG
GAT
gtgagcgatggcccaggacccctgctggcccggggggcgggggacccctctacaccatgc
ctgccctcagccctgtacaggcccctccacagcaccccacctgctgaatccagcccctgc
tctgcgtcctcccaccagggggaaggctgttggtctcacctgggcccctgaccccgttct

Exon 16 +      42929      43075   0   Internal    147   100   Excellent
gatggcccaggacccctgctggcccggggggcgggggacccctctacaccatgcctgccc
tcagccctgtacaggcccctccacagcaccccacctgctgaatccagcccctgctctgcg
tcctcccaccagggggaaggctgttggtctcacctgggcccctgaccccgttctctccag
GACCAGGAGAAGGTGCTGGACAAGTATGAGGACGTGGTGCAGGGGCTGCAGAAGCGAGGC
CAGCAGGTGGTGCCCCTCAAGTACCGCCGGGAGACTCCGCTCAAGCCCATCCCCGTGGAG
GCACTCTGTGACTTTGAGGGGGAGCAG
gtgcgtggggccagctcctctgttcacatcactacaaagtttttggggtaacatggttgg
atcccgggcctcaggcgccgttctcaggagcctgtgcctgtctccgtggttggtgtcact
ctgccaacccttcccctggtgcaggccaactggcacccctatgccgcccccacctcggct

Exon 17 +      43718      43889   0   Internal    172    97   Excellent
tgctgggccggcagcctcaacacatgtgcttctcctgcatgcccctccccactctacggg
gagggtccaagtgatgagccggggctccccaggtccaagagtcgggggctgagatggcaa
ccgggctcccaggccctcaggccctgccgggatcctgactgtccagcctgcccccgccag
GGCCTGATCTCGCGGGGCTACAGCTACACCCTGCAGAAGAACAACGGGGAGAGCTGGGAG
CTCATGGACAGCGCTGGGAACAAGCTGATTGCTCCGGCCGTGTGTTTTGTGATCCCCCCC
ACAGACCCTGAGGCCCTGGCTCTGGCTGACAGGTACAAGGGCAAAGGCGGGA
gtctgcatggaccagtcccacccccagggcttctcaggccccattcatagccccggggat
ttggactcagcctgtggggagcgcggggtcgctgacactctccatctgcacccccttgga
agttcatgcaggagaggggcagattgtgggccagctgacttgctaaacatgaatgtctag

Exon 18 +      44698      44795   2   Internal     98   100   Excellent
gaagagctctgagcccaggagcacagaaaggccagtgccacagtgagcacttgctgtccg
catctaaggagctgtcaggctcctctggggtgtctgcccagccagagtccgcagtcccgc
ctctgtgggtgcagggggtggtgggctgcccaggttcccagctcatttctgtcctcacag
CCTGGGCAGCCAGTACCGGAGCGTGCGGCAGAAGGCAGCTGGGAGCAAACGCACGCTGCA
GCAGCGGTATGAGGTGCTGAAGACCGAGAATCCCGGAG
gtgggtgccagggccactcgcctgaggctctgggggtaccggggaggaggggctggacca
gggtctgtgctgtggatgagacggcggggggctggctgcctaggtccatccctgggcctc
acacccctggcccgttgtcacacctgcctgtgtcctccctccctccacagatgcctctga

Exon 19 +      44966      45146   1   Internal    181   100   Excellent
aatcccggaggtgggtgccagggccactcgcctgaggctctgggggtaccggggaggagg
ggctggaccagggtctgtgctgtggatgagacggcggggggctggctgcctaggtccatc
cctgggcctcacacccctggcccgttgtcacacctgcctgtgtcctccctccctccacag
ATGCCTCTGACCTACAGGGGCGGCAGCTGCTGGCTGGCTTGGACAAGGTGGCCAGCGACC
TGGACCGGCAGGAGAAGGCCATCACAGGGATCCTGCGGCCACCACTGGAGCAAGGCCGGG
CTGTGCAGGACAGTGCCGAGCGGGCCAAGGACCTCAAGGTACCTGCGGGTCAGGAGCACA
G
gtggggccgggggagccctgcactggccccctggggcccctatttgaggtcttttcccca
tggagtcttgggatattcactgcagctgtctgtcagggacagcctgctgcatgtaaaagg
gtcccaagtcatggaggtggcagggctgctgtcattacctccccaggagaaagagctggc

Exon 20 +      46071      46301   2   Internal    231    91   Excellent
ggtgcttctggtgtcactagtccattccacctcagcggttccctgggatgctcgtgaaaa
atacagccctcaggctggggtccagatgccgggtcagagccccagaatgtgccaggcctc
tccagctgcttccactgtgcctgatgtgggaatctgtgctcaccctgggcacatcctcag
GGGAAGGGGCTGCCTGGCTGTGTCCAAAACTGAGGGGCCCTGGTTCCCACAGAACATCAC
CAACGAGCTACTGCGGATTGAACCTGAGAAGACGCGGAGCACGGCTGAGGGCGAAGCCTT
CATCCAGGCCCTCCCAGGCAGTGGCACCACACCCCTGCTGAGGACCCGGGTGGAGGACAC
CAACCGGAAATACGAGCACCTCCTGCAGCTGCTGGACTTGGCCCAGGAGAA
gtgggtggcagacaggcagcatggaggttggggtggggtcagggggccaggtgggcatcc
cccgacgcctgattggtgctctcagggttgatgtggccaaccgcctggagaagagcctgc
agcagagctgggagttgctggccacacacgagaaccatctgaatcaggatgacacagtgc

Exon 21 +      46387      46525   2   Internal    139    98   Excellent
ggcagtggcaccacacccctgctgaggacccgggtggaggacaccaaccggaaatacgag
cacctcctgcagctgctggacttggcccaggagaagtgggtggcagacaggcagcatgga
ggttggggtggggtcagggggccaggtgggcatcccccgacgcctgattggtgctctcag
GGTTGATGTGGCCAACCGCCTGGAGAAGAGCCTGCAGCAGAGCTGGGAGTTGCTGGCCAC
ACACGAGAACCATCTGAATCAGGATGACACAGTGCCTGAGAGCAGCCGTGTCCTGGACAG
CAAGGGGCAGGAGCTGGCG
gtgagtctagggcccaagtcctgggagtccttctctgagcaggtgagagcatctggcaca
tccacccgcccgtctggatagatgaggacaccagcatccagtctccccaggtttggaatg
cccaaattgggaactgcaaatggaggcccacagcacaaatccaagctattcacgggatct

Exon 22 +      47415      47608   0   Internal    194    96   Excellent
aaaacagaagatggcagaagtgacccaggtttgggatgtacagagcaaggctccggtcct
tcctacctgtggccttgcccaccctcctacagtcagtggcccaggggcttcagtgggtgt
catcgcctggctctgggagctctggccgtagcaccgccgtctcctcctctgccccgccag
GCCATGGCCTGTGAGTTACAGGCCCAGAAGTCCCTCCTGGGTGAGGTGGAGCAGAACTTG
CAGGCGGCCAAGCAGTGCTCGAGCACACTGGCCAGCCGCTTCCAGGAGCACTGTCCGGAC
CTGGAGCGCCAGGAGGCCGAGGTGCACAAGCTGGGCCAGCGTTTCAACAACCTGCGCCAG
CAGGTGGAACGCAG
gtgagggtgcggtgggtggtggccatttttgttttctgagaatgcgatctaattccctct
aagcaatgctttagccgtgtcccacagattttgctgtttttctttttggtgagttcgtca
gattctctgacggccctgtggtctctcttttgagtcatgcttacctgggtcctgtaatcc

Exon 23 +      48002      48152   2   Internal    151   100   Excellent
acccacctggttctccacagtccaacctgacgttccctaatgaccacccaccctgtgtgg
gagatacttggggtatttctggttgttacatttggttgtttcccactttaaaaaaaaaaa
tgagggctcggtgaggcatctgtttgctgtggctgaggcctgaacgctttgccttgacag
GGCGCAGAGCCTACAGAGCGCCAAGGCAGCCTACGAGCACTTCCACCGCGGCCATGACCA
CGTGCTGCAGTTCCTAGTCAGCATCCCCAGTTACGAGCCCCAGGAGACAGACAGCCTCAG
CCAGATGGAGACCAAGCTGAAGAACCAGAAG
gtgagatggccgtttccgcagccccaggcacacactggcaagggagggtcagaggtcaac
aagcccctttctggggagccaagcctttgggaggtggagcagggcagaggcctgccacag
ctgtgtcctccctgggcctcagctcaagctcccaacacccaaccctctgagaacaagaac

Exon 24 +      49275      49358   0   Internal     84   100   Excellent
caacaacaacaaaaaaactgccttttgcaatgaataaaaatgtatacaagggagccattc
atcatactttgtgctagagaagaataaattcagattctgagatttccagctactgcatcc
atggttgcttttttaaattttttttctggttagttttgatttttaaactctgtcttacag
AACCTGCTAGATGAGATAGCAAGTAGGGAGCAGGAAGTACAGAAGATCTGTGCCAATTCC
CAGCAGTACCAGCAAGCTGTAAAG
gtgagccgggaaacttccgcccaaagcacaaacagcaggggtcttattccaccgtgccct
ggtcagagaagcagcaagcaccggccctggcacatgggggtggagctggccatccgaggc
actgccggctgctgtgcaaactggcacaggcttttgggaaaacagcatggtactagacat

Exon 25 +      49425      49791   2   Internal    367    50    Marginal
tagttttgatttttaaactctgtcttacagaacctgctagatgagatagcaagtagggag
caggaagtacagaagatctgtgccaattcccagcagtaccagcaagctgtaaaggtgagc
cgggaaacttccgcccaaagcacaaacagcaggggtcttattccaccgtgccctggtcag
AGAAGCAGCAAGCACCGGCCCTGGCACATGGGGGTGGAGCTGGCCATCCGAGGCACTGCC
GGCTGCTGTGCAAACTGGCACAGGCTTTTGGGAAAACAGCATGGTACTAGACATGGAATG
CTGTAAAAGGGTTTTATACTCTGAAGCAGTAAACACTTTGGGGGAATTTATCCTTAAGGA
AAAAGTACAAAAAAAAAAATGCAGGATAAACAACATTGTTGCAACAGCACTATTTACAAT
AGCAAAACTAGTACGCTGGAAAGGACTGGTGTCCAGTGGAAGGGGAAAGCTGCGTGAATC
AGCACACATCCACCTGATGGATTATAAAGTCAGCAAGCTGGTAAACATGAGAAGAGGTGG
TGGCAAG
gtgagacagggttatggtacgatgttaaaagcagcagcagaatgtgaaaatctctaggca
tgtagaaaggctgggaggggaattcagggggcacttcttgtctcatatgttactgagtga
tggagctatgtactgctgagatatcagtaattctcaaaacctcctggaaatcactgcagg

Exon 26 +      50118      50234   0   Internal    117    88        Good
gtaattctcaaaacctcctggaaatcactgcagggtgcagctgtgaggaagacccacgca
gattataaaaccagcacatggcacagggcaggtctgggtcagcctgaaggggtacaggaa
catgtctgtctcttctcagctgttttaatctcccctctgccatgtctctccctcatgcag
GACTATGAGTTAGAAGCAGAAAAACTAAGGTCTCTTCTCGACTTGGAGAATGGAAGGAGA
AGCCACGTGAGCAAGAGAGCCAGGCTCCAATCTCCTGCCACCAAAGTGAAGGAAGAG
gtgagttccatgggccaggcggcctcgggactgaggtggaggccaagctgccctgctccc
cagggagcatggtgtcacacgctggcctcagagatgcacacacaacagggaagccactga
gagccctcctgcatgcaaacaggtttggtaagagatgaggaacttgttctagggcagtga

Exon 27 +      51109      51201   0   Internal     93   100   Excellent
atccatttttctctccaccggtgaggctacagtctaactccaggcaggagtgggcaagag
ctatgcctctacccccaaattccacacttctcaagaaccacgtccacgctgtctagctct
ctgttgcttaccctgttgacacctgtttgttgaccgctctcctaatcctcttctctgcag
GAAGCAGCACTTGCCGCCAAGTTCACTGAAGTTTATGCCATCAACAGACAGAGGCTGCAG
AATCTGGAGTTTGCTCTGAATCTCCTCAGACAG
gtaactgatcttagtaagaaattctacttcaggctgttctaacaggtgacaaatacagac
tctgtcttagagaaatggtttgtgaattgatggaagtgtccccttgctaacgtttctggg
cagggccaatgcaaagactggcccgagccaatgcttctactgacatgagaacttattcaa

Exon 28 +      52289      54952   0   Terminal   2664    92   Excellent
aaccccaaactagttgtttgatcctttttgaaagtaaccctagaactctacaactaacat
gaactggcactgagggagtcccttggggaccacaggacagccactctgaccaggtgggga
caggccctacatgtgctgccagagcctggctttaaccttgtcttgtcttctccatcacag
CAGCCGGAAGTAGAAGTGACCCATGAGACCCTGCAAAGGAATAGGCCGGACTCTGGAGTG
GAGGAGGCGTGGAAGATCAGGAAGGAACTGGATGAGGAGACTGAGCGGAGGCGGCAGCTG
GAGAACGAGGTCAAGAGCACCCAGGAAGAAATCTGGACCTTGAGGAATCAGGGGCCTCAG
GAATCGGTGGTGAGGAAGGAGGTGCTCAAGAAGGTGCCGGATCCCGTGCTGGAGGAGAGC
TTCCAGCAGCTGCAGCGGACGCTGGCAGAGGAGCAGCACAAGAACCAGCTGCTGCAGGAG
GAGCTGGAGGCACTGCAGCTGCAGCTGCGTGCCCTGGAGCAGGAGACCAGAGACGGGGGG
CAGGAGTACGTGGTCAAGGAGGTCCTGCGCATCGAGCCTGACAGGGCCCAGGCGGATGAG
GTCTTGCAGCTGCGGGAGGAGCTGGAGGCACTGAGGCGGCAGAAGGGCGCCCGGGAGGCA
GAGGTGCTCCTCCTGCAGCAGCGTGTGGCCGCCCTGGCTGAAGAGAAGAGCCGGGCGCAG
GAGAAGGTCACAGAGAAAGAGGTGGTGAAACTGCAGAATGACCCCCAGCTGGAGGCAGAG
TACCAGCAGCTGCAGGAGGACCACCAGCGCCAGGACCAGCTCAGGGAGAAGCAGGAGGAG
GAGCTGAGCTTCCTCCAGGACAAGCTCAAGAGGCTAGAGAAGGAGCGGGCCATGGCCGAG
GGCAAGATCACCGTCAAGGAGGTGCTCAAGGTGGAGAAGGACGCGGCCACCGAGAGGGAG
GTCAGCGATCTCACCCGCCAATATGAGGACGAGGCTGCCAAGGCTCGCGCTAGCCAGAGG
GAGAAGACGGAGCTGCTCCGAAAGATATGGGCCTTGGAGGAGGAGAACGCCAAAGTGGTG
GTGCAGGAGAAGGTGCGGGAGATCGTGCGGCCAGACCCCAAGGCGGAAAGTGAAGTGGCG
AACCTCCGCCTGGAGCTTGTGGAGCAGGAGCGAAAGTACCGGGGTGCCGAGGAGCAGCTC
CGGAGCTACCAGAGTGAGCTGGAGGCCCTCAGGAGGCGAGGCCCCCAGGTGGAAGTCAAA
GAGGTGACTAAGGAAGTCATTAAGTACAAGACTGACCCTGAGATGGAGAAGGAGCTTCAG
CGGCTCAGGGAGGAGATCGTGGACAAGACCAGACTGATCGAAAGGTGTGATTTAGAGATC
TACCAGCTGAAAAAGGAAATCCAGGCCCTGAAAGACACCAAACCCCAGGTCCAGACCAAA
GAGGTGGTCCAGGAGATCCTCCAATTCCAAGAAGACCCTCAAACCAAGGAGGAGGTGGCG
TCTCTGAGGGCAAAGCTCTCAGAGGAGCAGAAGAAACAAGTGGATCTGGAGAGGGAAAGA
GCTTCCCAGGAAGAGCAGATCGCCCGGAAAGAGGAGGAGCTCTCGCGGGTGAAGGAAAGG
GTGGTGCAGCAGGAGGTGGTCAGGTATGAGGAGGAGCCAGGCCTGCGGGCCGAGGCGAGC
GCCTTTGCCGAGAGCATCGATGTGGAGCTGCGGCAGATTGACAAGCTGCGGGCAGAGCTG
CGGCGGCTGCAGCGCCGGCGCACCGAGCTTGAGCGGCAGCTGGAGGAGCTAGAGCGCGAG
CGGCAGGCCCGCAGGGAGGCCGAGCGCGAGGTACAGCGGTTGCAGCAGCGGCTGGCAGCG
CTGGAGCAGGAAGAAGCTGAGGCCCGTGAGAAGGTAACCCATACGCAGAAGGTGGTGCTG
CAGCAGGACCCGCAGCAGGCGCGAGAGCATGCCCTGCTCCGACTCCAGCTGGAAGAAGAG
CAGCACCGGCGGCAGCTCCTGGAGGGGGAGCTCGAGACCCTCCGGAGGAAACTGGCTGCA
CTGGAGAAGGCGGAGGTCAAGGAGAAGGTGGTGCTCTCCGAGAGTGTCCAGGTGGAGAAG
GGCGACACCGAGCAAGAGATCCAGAGGCTCAAGAGCAGCCTGGAGGAGGAGAGCCGCAGC
AAGCGCGAGCTGGACGTCGAGGTGAGCCGGCTGGAAGCCAGGCTTTCGGAGCTGGAATTC
CATAACTCCAAGTCATCCAAGGAACTAGACTTTCTGAGGGAAGAGAACCACAAATTACAG
CTGGAGAGGCAAAACCTGCAGCTGGAGACCCGAAGGCTCCAATCGGAAATCAACATGGCA
GCGACGGAAACACGAGACCTGCGGAACATGACCGTGGCGGACTCTGGGACCAACCATGAC
TCCAGACTGTGGTCCCTGGAGAGGGAACTGGATGACCTCAAGAGGCTCTCCAAGGACAAA
GACCTCGAGATCGACGAGCTGCAGAAGCGCCTGGGCTCCGTGGCCGTCAAGCGGGAGCAG
CGGGAGAACCACCTGCGGCGCTCCATCGTAGTCATCCACCCTGACACAGGCCGCGAGCTG
TCCCCGGAGGAAGCCCACCGTGCCGGGCTCATTGACTGGAACATGTTCGTGAAACTCAGA
AGCCAGGAGTGCGACTGGGAGGAGATCTCAGTGAAGGGTCCCAATGGGGAGTCCTCAGTG
ATACACGACAGGAAGTCTGGCAAGAAGTTCTCCATCGAAGAGGCCCTGCAGAGTGGCAGG
CTGACCCCTGCTCAGTATGACCGCTATGTCAACAAGGATATGTCCATCCAGGAGCTGGCG
GTCTTGGTATCTGGGCAGAAGTAG
gcacagctcttgcaactcttcgtaacggcagacgctggccctctcctacgacgcagtgac
ctccttggtgtcgtcctctcccttgccctggtgcaggccaagcattttatacataccctc
gctgccaggctgctcagagtcccgcccacatatgagacaggcactggctgaagacaggca

--------------------------------------------------------------------------------