--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (11736 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (12 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1259       1344   0    Initial     86    73        Good
tacattttaaagcaggaggccgcagaagacgctcggcagttctggcctccgagcagcagg
cggcgctgtgagtcgtctttgcggaagccgcggaggcctcgctgactgacttccggtgtt
ggcggtggcgccgcgcagtcaccgcggagcagacgcggaggctggtggcccctgggcgag
ATGCCGTACGCCAACCAGCCTACCGTGCGGATCACGGAGCTCACTGACGAGAATGTCAAG
TTCATCATCGAGAACACCGACCTGGC
gtaaggctaccgagggaagaggctggcggctctggggcgccgggaggcccaagccggggc
cccggggcagggggcgggggtgtagtggggtggggtgggggcgatgtccttccagagctg
cccccctgcaccagggctttagctttgggagcctgcggcgcgggcccagcctgtcgaggc

Exon  2 +       1563       1612   2   Internal     50    81        Good
gccgggaggcccaagccggggccccggggcagggggcgggggtgtagtggggtggggtgg
gggcgatgtccttccagagctgcccccctgcaccagggctttagctttgggagcctgcgg
cgcgggcccagcctgtcgaggctgcagcgccttcacgccccttggcttttgatctttcag
GGTGGCCAATTCGATTCGGAGGGTCTTCATCGCTGAGGTTCCCATAATAG
gtaagcgactccccttcctcgttcccgcgcccacgggttcctgccccgctctccacccac
acactctttggggctccttccagtccttggttcgggctgagggtggtagtgctgagaaaa
gtgcattgctggagacttgaccataccctgtgcccttggctcagtggccgcctccctggc

Exon  3 +       2764       2855   1   Internal     92    68    Marginal
acttgggcaagttattaaacttctgtgtgctgcagtttcctcatctgtaacattcggcca
ctaatgatccttatcagggtaatgttaaggattaagtgaggtaatccatataagtgcttt
gtgtttagtgagtgctcagtgctggtagatggcttttttattaatctattccttcaacag
CATTTATGGAGCATGAAAGTGGCAGGCATGGTGGTAAGCTCTGGGAATGCAAAGCTGTAG
AGAACAGGGTTTTTGCCCTCATGGAGTCCACA
gtgaggttgtaggggagagatgaatccacagacaacactaaagcaaggtagattttgatc
agtagttcaggagaagcatagctgtggtgcacttggctcttagaggagggaagatcaatt
tctggtctggttccagccactctgctccaggtgcttaatgcattgattatacttgtatga

Exon  4 +       4487       4555   1   Internal     69   100   Excellent
ggtgtggtgtgtgtgggtcttattaaaatgcaagtacctgggccccactctaatgctgtg
gaatcagcccagcaatctgcagtttagtgtcaggtgattcctaaatcttgagaaccactg
cattaagtctgtaggtaaatttgatggctaaactccatgtctgcttctttcattttttag
CCATTGACTGGGTTCAGATTGATGCCAATTCCTCAGTTCTTCATGATGAATTCATTGCTC
ACAGGCTTG
gtgagtactccttttactaggaggttaaagggagggtattgtgcctagtgtcaggagggg
gcctccttccagcctcacccccagaaggcttctgggttctcattttggcttggctgtttg
gttttctttaaagtgcttttctgttttttacaggattaattcccctcattagtgatgaca

Exon  5 +       4709       4785   1   Internal     77    99   Excellent
atgatgaattcattgctcacaggcttggtgagtactccttttactaggaggttaaaggga
gggtattgtgcctagtgtcaggagggggcctccttccagcctcacccccagaaggcttct
gggttctcattttggcttggctgtttggttttctttaaagtgcttttctgttttttacag
GATTAATTCCCCTCATTAGTGATGACATTGTGGACAAGCTGCAGTACTCTCGGGTATGTT
GTGTGATTGGGTGGAAT
gtgaggtttggtggggaggctttggttctcaaagggatttttcctgacatttggcatcca
gcttgaatactgttgtagttctggaacaacaacgtggagatgttgtctagagcctgggca
ggccttggtcctgcgttctgatggggcttcagattgattagcacgcagaacatcagggag

Exon  6 +       7431       7457   0    Initial     27    71        Good
ttgaaaggtacttttttctgttccttggtggttttattttaaatgatggttacattccca
agctggtcctcttagttcttgggaagctgaactatagagtgtgaaagcattctcctgtgc
ctcatagccttggttctctgaggaagagtagttcaagggccagagggagatgttagcaat
ATGTCCCCAGAGGTGGCCTGGCAGCTG
gtgggagtgggaaagaaatgtgcgtgccagtgtatgtataagttgtctctaaacttgggc
agtccatgagaatggtataccagattgtcacagcccacaagaacctggatactgatgaac
ccctttttacaggtgaagaaacttaaggaactgggcattagatgcaggaagccaagacaa

Exon  7 +       7699       7827   0   Internal    129   100   Excellent
gtccatgagaatggtataccagattgtcacagcccacaagaacctggatactgatgaacc
cctttttacaggtgaagaaacttaaggaactgggcattagatgcaggaagccaagacaag
gagccaaggcaggagttgccatctccctttgactcattcctgcttcccttcctgccttag
GACTGCACATGTGAGGAGTTCTGCCCCGAGTGCTCGGTGGAGTTCACCCTCGATGTGCGG
TGCAATGAAGACCAGACGCGACATGTCACGTCTCGAGACCTCATCTCCAACAGCCCCCGG
GTCATTCCG
gtcagtgcgggagagcatcctcttttccctgggatcttttctcttctctggctggctcca
agtgggccagactggggttgatccttagaaaatgttggctttccctgttaccctctgcct
taatctgatccctagaagtgctaattctggattcctcttgggcatcgttagcatcgttgg

Exon  8 +       8244       8295   0   Internal     52   100   Excellent
ctgaggctaccaccacaccctgaagtgggggttggagtcctgggggcatctgtgccacca
cctcgtcaggtgttcgttccctggttgacagattgcagtctagaggtgctgggatatgga
tgccagaggaggtgactggggaggtgagcagctaatgaatgcctggtggactccctacag
GTGACATCCCGGAACCGAGATAATGACCCCAATGACTACGTGGAGCAGGATG
gtaagtcttcctgacctgtcaccgtgtgggccagcgggaaggagggaccagacacagcct
ctcgtgctgcctggtctcctcgaaaattggctttagaccgtttttccagatgtgtgtggt
cttgcagtggcactccaagtcagaatttggagaagcatgtctctcctggcccttgactga

Exon  9 +       8495       8699   1   Internal    205   100   Excellent
caccgtgtgggccagcgggaaggagggaccagacacagcctctcgtgctgcctggtctcc
tcgaaaattggctttagaccgtttttccagatgtgtgtggtcttgcagtggcactccaag
tcagaatttggagaagcatgtctctcctggcccttgactgacttgtgcctctccctgcag
ACATCCTCATCGTCAAGTTGAGAAAGGGCCAGGAGCTGAGACTTCGAGCCTATGCCAAAA
AGGGCTTTGGCAAGGAGCATGCCAAGTGGAACCCTACTGCAGGGGTGGCTTTTGAATACG
ATCCAGACAATGCCCTGAGGCACACAGTGTACCCCAAGCCCGAGGAATGGTATGTTCCCC
TTAGGAGTGATGGCAGGCATTTGGG
gtgggtgtggcatagaaatggctgttgttgactgagatgtggcaggctctctaggaactt
gggtgccccaaaaggagcagtggcaaccttgtgctgacctgtgtttgacctcaggccaaa
gagtgagtactcggagctggatgaggatgagtcgcaggctccctatgaccccaacggcaa

Exon 10 +       8814       8888   2   Internal     75   100   Excellent
gcacacagtgtaccccaagcccgaggaatggtatgttccccttaggagtgatggcaggca
tttggggtgggtgtggcatagaaatggctgttgttgactgagatgtggcaggctctctag
gaacttgggtgccccaaaaggagcagtggcaaccttgtgctgacctgtgtttgacctcag
GCCAAAGAGTGAGTACTCGGAGCTGGATGAGGATGAGTCGCAGGCTCCCTATGACCCCAA
CGGCAAGCCAGAAAG
gtaagagcctggttggacatgggaaggtgaagtgtggaagaagggatggttttggttcag
gccgtgagttaggcattccctctcccccacctcgcagttctcataagctgaggaggggct
gctgactgctaaactagacctgtggtatgtgcacatcccaggggcaggtcgtcagcccct

Exon 11 +       9509       9653   2   Terminal    145    62    Marginal
aaagtgtgttgaaactaccctatgtaagaggttttacatgaaaggaagttagccctggcc
caaggtcaagttccatgtgggaacagagccaagacccggaaggaggaagggttgtccatg
gccagagctcgggtcggccagcctgcctcgcagtgcactcactggactcttgcctcctag
GTTTTACTACAATGTGGAGTCCTGTGGCTCTCTGCGTCCTGAAACCATTGTCCTGTCAGC
CCTCTCAGGATTGAAGAAGAAACTGAGTGATTTACAAACTCAATTAAGCCACGAGATCCA
GAGTGATGTGCTAACCATAAATTAA
ctgcagcttgcctgcttcagcaaaaacggagattcaggccagcagctggatatgggggtc
tctcttcagactcttctcgtttctgagaatctagtctactgttggttgagcttcttggca
ggacatcagtaccaactagaagtgggtcatagatagattaccagggatgcagtggtgttt

Exon 12 +      10226      10266   1   Terminal     41    92   Excellent
aagtgccatagcctttattcagggggcctataaacccttccagttcttgccccagggctg
gcctgctagcgcttcaaattcccaggtgtccctaatttgagaagtaaccttttggaatag
cattagaccctggctgtcccctccccaccaaataaacatgatatttcattctctgtccag
CAGTCATGAACCCCTTCACCTCCAATGACCTGATCATTTAG
tttggtgggggtgggggtgggggtgggggtggaagcagccgcaggagcaagggcccctcc
cacatacacaggaggagtatttcatttctccttaatgaaggctctggccctaacccctca
gcactgtctccagataggaacatgcacaaagcagttaattaggcagcctggagaaaacca

--------------------------------------------------------------------------------