--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (10169 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (16 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        197        249   1   Terminal     53    71        Good
cgagtcacgatagaaaacccactctgtggagagaccagagatgaccgccgcgcacacctc
cgttcagcacacaaacctttgcaggtgttcatagcggaggcagattccgtactggggata
agagctcacgacatgctgggaggggtttcaggggcagggagggggcttctgtggccccag
GTCAGGAGGAGCAGCTCTTCCATCAGCAGCAGGCAGCCAGCCCAGATGCGTAG
ggaagacagctcccacttcgccaggccagagagcgcccgggggcagctctgttccagtcg
accctgcgagaaaggggtgtgcgtgtgcctggagctgggccccgtcctgcctccctgacc
tgtgtgctcccacagccctgagacggacggctcacagccttgcgaggcccacactgcact

Exon  2 +       2001       2021   0    Initial     21    59    Marginal
tctgtcacccggaggctgtgtgcctccccgcgacattccccagtggccgggccgaccagg
caggctctgcctgtggatggggctgctgagcatgagcgtgtgacccccatttctgagctg
tgggtggacccaccgggcctgggccaaggttttcaggaggcagctctattctactccgcc
ATGGTGGCCTCCCTGAAAGGG
gtgagtgtagaagccagttccctcttctgcgagccccacccctaccccaggaggacaatt
cttgttcagggagggtctccccacccacttccccaccccacagtggcccacaggccccac
cctagagagtacaaggggctccccaggctgctcactggcccagccccgccccacctggac

Exon  3 +       2777       2898   0   Internal    122    87        Good
agtccaggggacagagggctcagtggctggagggcagggccagggtgcggacacaagctg
caggtaccacagaagtttgctctgggagcccctcctgggcccatgtggccccaggctggc
ccaggacagaggcgtggggtgggagcagggggtcccatcctgagtcactgccctccacag
ACACAGACCATGGCCTTGCCAACGGCTCGACCCCTGTTGGGGTCCTGTGGGACCCCCGCC
CTCGGCAGCCTCCTGTTCCTGCTCTTCAGCCTCGGTGCGTACTTGATGGGGCTGCTGGTG
AG
gtggggacggcccaggggccttgggggccaggcccccagcaaggctttgcctgcccctgc
cttctccctggagtgcctgtggtggccacgtctcagcagcagtctctgcccccagaggtg
actggagctggagatccagccagggagtgatggggctcaggacacagtggggatgtctgt

Exon  4 +       4128       4248   2   Internal    121    76        Good
tgacacccctcaggtgatggcaactcccggcccttgagggcgtcacctggtcttgggggg
aggtctgcagggagcaccagggtcctttggggagaggtggggctgtggggcttggggagc
actgggtggacattgcaggggaggggcgatcgtgggtgcccagcccgacccttcctgcag
CCTCTCCCCTCGCCAACTCCTTGGCTTCCCGTGTGCGGAGGTGTCCGGCCTGAGCACGGA
GCGTGTCCGGGAGCTGGCTGTGGCCTTGGCACAGAAGAATGTCAAGCTCTCAACAGAGCA
G
gtcagtctcagttgggctgaggcaggtgggcacagctggggctgaggaattcacaggcag
ctctgcagtgcccaccttgccaccacggtcccctctgtccctgctgccatctctccccgg
ccagttcttcccagagttcctctggccacccaagctgaccactggggtgcctgtccacgt

Exon  5 +       4601       4835   2   Terminal    235    48    Marginal
gtccacgtcaggggctggctccccaggagcaagtctgatatgacgctgtgtgctgggccc
cctcctggagcgccgtgggcagccctccaggctctgccccaagggtgaatctttttcggg
ggagtgggtgagatctggggaaggggagcggagccaggcacgggagcccccatcccccag
GGCAGCGCTGCAGGCGGCCAGAGATCCACTTCCACAGATTCTCGTGGCCAGGGCAGGGGT
GTGTTGTGGTGGGCAGACTGGCCAGGCGACCCTGGCCCACCATGTGAGTGGCGGCTCGAA
ACGCTCTGTGCTGGACTCCCTGCCCCTGCAGCTGCGCTGTCTGGCTCACCGGCTCTCTGA
GCCCCCCGAGGACCTGGACGCCCTCCCATTGGACCTGCTGCTATTCCTCAAGTAG
gccctgccccctgaacccacccccccggcttttgccgccagccctcagcccccaaccccc
tgccccttgcctcggatcccaggccacagcagagatgtggaggccggccgggctgcctct
cagggtggggacgggtgtgatcagtgcggcctgtccccagcaccctctcttcacagccca

Exon  6 +       5037       5141   0   Internal    105    89        Good
cccccggcttttgccgccagccctcagcccccaaccccctgccccttgcctcggatccca
ggccacagcagagatgtggaggccggccgggctgcctctcagggtggggacgggtgtgat
cagtgcggcctgtccccagcaccctctcttcacagcccagatgcgttctcggggccccag
GCCTGCACCCGTTTCTTCTCCCGCATCACGAAGGCCAATGTGGACCTGCTCCCGAGGGGG
GCTCCCGAGCGACAGCGGCTGCTGCCTGCGGCTCTGGCCTGCTGG
gtaggggctggggccagcgcggggcggagagggctcggcagttccaaaagcgctgaggcc
agcctctctgcagggtgtgcgggggtctctgctgagcgaggctgatgtgcgggctctggg
aggcctggcttgcgacctgcctgggcgctttgtggccgagtcggccgaagtgctgctacc

Exon  7 +       5215       5328   0   Internal    114    59    Marginal
aggcctgcacccgtttcttctcccgcatcacgaaggccaatgtggacctgctcccgaggg
gggctcccgagcgacagcggctgctgcctgcggctctggcctgctgggtaggggctgggg
ccagcgcggggcggagagggctcggcagttccaaaagcgctgaggccagcctctctgcag
GGTGTGCGGGGGTCTCTGCTGAGCGAGGCTGATGTGCGGGCTCTGGGAGGCCTGGCTTGC
GACCTGCCTGGGCGCTTTGTGGCCGAGTCGGCCGAAGTGCTGCTACCCCGGCTG
gtgagctgcccgggacccctggaccaggaccagcaggaggcagccagggcggctctgcag
ggcgggggacccccctacgggtaagtgaaggtgtctggaacctcgaaggctcacctggcg
gcgtggtatcagcagcgtgaggacacttgcggccatgcctcaaggcccagggtcagtcac

Exon  8 +       5660       5722   0    Initial     63    95   Excellent
gccatgcctcaaggcccagggtcagtcacccccgccaccacccctgccaatgcccccagc
gtcccctccacagccagggggtacggcctggcctcttccctctctggggctgcacgtggg
gggtccctgagctgtgtcccgtgtctgcacagccccccgtcgacatggtctgtctccacg
ATGGACGCTCTGCGGGGCCTGCTGCCCGTGCTGGGCCAGCCCATCATCCGCAGCATCCCG
CAG
gtgagaccccaatccccagcccgtggggatgcccggccacccgaggctcagcccaggtcc
tgctcgtcctcagggcatcgtggccgcgtggcggcaacgctcctctcgggacccatcctg
gcggcagcctgaacggaccatcctccggccgcggttccggcgggaagtggagagtgagtg

Exon  9 +       5796       5895   0   Internal    100    81        Good
tcccgtgtctgcacagccccccgtcgacatggtctgtctccacgatggacgctctgcggg
gcctgctgcccgtgctgggccagcccatcatccgcagcatcccgcaggtgagaccccaat
ccccagcccgtggggatgcccggccacccgaggctcagcccaggtcctgctcgtcctcag
GGCATCGTGGCCGCGTGGCGGCAACGCTCCTCTCGGGACCCATCCTGGCGGCAGCCTGAA
CGGACCATCCTCCGGCCGCGGTTCCGGCGGGAAGTGGAGA
gtgagtgccgtgccctgcgcagtctggcaccaggctgggcagcacccctgggggtgggca
tcactttagggtctcacctgcccctccctggctctgcagcacatcccattataatcacag
agagtggacagaatccctgtttgccagtgggtaaactgaggcacagggagggtcacaaat

Exon 10 +       6164       6345   1   Internal    182   100   Excellent
tggctctgcagcacatcccattataatcacagagagtggacagaatccctgtttgccagt
gggtaaactgaggcacagggagggtcacaaatggcccgaggtctcatctcacaggaggtg
tgggaggaagaaggggtcaaacgaactccggccctgacccctgacccctgtgccctgcag
AGACAGCCTGTCCTTCAGGCAAGAAGGCCCGCGAGATAGACGAGAGCCTCATCTTCTACA
AGAAGTGGGAGCTGGAAGCCTGCGTGGATGCGGCCCTGCTGGCCACCCAGATGGACCGCG
TGAACGCCATCCCCTTCACCTACGAGCAGCTGGACGTCCTAAAGCATAAACTGGATGAGG
TA
gttcatgactcaagttcccaccggcctgctgtgtccaagccatccccagcccctctggga
gtgacatgggccctcctggtctcttggcctgcagctctacccacaaggttaccccgagtc
tgtgatccagcacctgggctacctcttcctcaagatgagccctgaggacattcgcaagtg

Exon 11 +       6440       6595   0   Internal    156   100   Excellent
tgctggccacccagatggaccgcgtgaacgccatccccttcacctacgagcagctggacg
tcctaaagcataaactggatgaggtagttcatgactcaagttcccaccggcctgctgtgt
ccaagccatccccagcccctctgggagtgacatgggccctcctggtctcttggcctgcag
CTCTACCCACAAGGTTACCCCGAGTCTGTGATCCAGCACCTGGGCTACCTCTTCCTCAAG
ATGAGCCCTGAGGACATTCGCAAGTGGAATGTGACGTCCCTGGAGACCCTGAAGGCTTTG
CTTGAAGTCAACAAAGGGCACGAAATGAGTCCTCAG
gtgaccgtccggctcgggggtcatgtggcatgagattgggaagggctgaggggcagagtg
ggggacaaagcctgaggttgggcgggcctggggtcaggggcacggcctgaggttatgctg
gtggtggagggatacatctctccttgccacaaggctcctcggcggcccctcccacaggtg

Exon 12 +       6773       6915   0   Internal    143   100   Excellent
caggtgaccgtccggctcgggggtcatgtggcatgagattgggaagggctgaggggcaga
gtgggggacaaagcctgaggttgggcgggcctggggtcaggggcacggcctgaggttatg
ctggtggtggagggatacatctctccttgccacaaggctcctcggcggcccctcccacag
GTGGCCACCCTGATCGACCGCTTTGTGAAGGGAAGGGGCCAGCTAGACAAAGACACCCTA
GACACCCTGACCGCCTTCTACCCTGGGTACCTGTGCTCCCTCAGCCCCGAGGAGCTGAGC
TCCGTGCCCCCCAGCAGCATCTG
gtgagtccccagaactctgcccggcaaggtgggtccgtgtgctggcgctcactgtccacc
caccgtgtccccagggcggtcaggccccaggacctggacacgtgtgacccaaggcagctg
gacgtcctctatcccaaggcccgccttgctttccagaacatgaacgggtccgaatacttc

Exon 13 +       6990       7117   2   Internal    128   100   Excellent
gccagctagacaaagacaccctagacaccctgaccgccttctaccctgggtacctgtgct
ccctcagccccgaggagctgagctccgtgccccccagcagcatctggtgagtccccagaa
ctctgcccggcaaggtgggtccgtgtgctggcgctcactgtccacccaccgtgtccccag
GGCGGTCAGGCCCCAGGACCTGGACACGTGTGACCCAAGGCAGCTGGACGTCCTCTATCC
CAAGGCCCGCCTTGCTTTCCAGAACATGAACGGGTCCGAATACTTCGTGAAGATCCAGTC
CTTCCTGG
gtgagccagggagtccctggccagggtgggcaacacaacgggggaagcacagactccact
cgggggtgccaggcctttgcctcgccgggccgtctgctgccagggtaactgggtggtcac
ccgccctctgccccccggggtgtgtatggccttaggggctgtgggttctgaccccagctc

Exon 14 +       7481       7575   1   Internal     95    99   Excellent
gcgccagccacctccagggtctcccacgcctgggggtcaggcggctaggcaaacccaggc
cctggaatccctaaggaaaaagggaagccctgtaaggcaagtgggcttcctgcagcctgt
ggtcaagggcctgggggtgtgaggtgaggcctcagctcgggcccctctcccggcgggcag
GTGGGGCCCCCACGGAGGATTTGAAGGCGCTCAGTCAGCAGAATGTGAGCATGGACTTGG
CCACGTTCATGAAGCTGCGGACGGATGCGGTGCTG
gtatggcgagcgggaggaggggcgtgtggaggaggggcccgtggaggaggggcgagtggg
aggaggggcgcgtggagggggggcgtgtgggggggtgcgtggaggaggggcgcgtggagg
aggggcgcgtggaggggggagcgtggggggcgtggaggaggggcgcgtggaggaggggcg

Exon 15 +       7941       8005   0    Initial     65    41    Marginal
aggggggagcgtggggggcgtggaggaggggcgcgtggaggggggagtgtgggggggcgt
ggaggaggaggggcgcatgggggggtgtggaggggggcgcgtggaggaggggcgcgtgga
ggggggagcgtggggggcgtggaggaggggcgcgtggaggggggcgcgtggggggggcgc
ATGGGGGGGCGTGGAGGGGGGTGCGTGGAGGAGGGGCGCGTGGAGGAGGAGGGGCGCATG
GGGGG
gtgtggaggggggcgcgtggagggggcacgtggaggggtcgcgtggaggaggggcgcgtg
gagggggccgtgtgggggggcgtggaggggggcgcgtggaggaggaggggcgcatggggg
ggtgtggaggggggcgcgtggagggggcgcgtggaggaggggcacatggaggggggggca

Exon 16 +       8484       8670   0   Internal    187    91   Excellent
tggggcctagggaagggcagccattgagctgaggtcagctggccggagacctccgaagtc
tggagaggctgcggtgggcatctgtgggtggggcagtttggacacaggagagcctggcag
ccctctggcggcgctgagggaaggagaccctccttgatggctgcccggggtctctggcag
CCGTTGACTGTGGCTGAGGTGCAGAAACTTCTGGGACCCCACGTGGAGGGCCTGAAGGCG
GAGGAGCGGCACCGCCCGGTGCGGGACTGGATCCTACGGCAGCGGCAGGACGACCTGGAC
ACGCTGGGGCTGGGGCTACAGGGCGGCATCCCCAACGGCTACCTGGTCCTAGACCTCAGC
ATGCAAG
gtgggcggggcggccaggccagggctgggggcagagctgggggcgtggaggtgggcgctc
tgagtcacccctctctctgtagaggccctctcggggacgccctgcctcctaggacctgga
cctgttctcaccgtcctggcactgctcctagcctccaccctggcctgagggccccactcc

--------------------------------------------------------------------------------