--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (19933 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (6 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1051       1093   2   Terminal     43    63    Marginal
ccattccacacccccccacactggctgtccccgtgggacttgaagtgcagagtccgctgc
tcaaccaggacagctgccctggctccctcccagcaagaacccccagaccctcatctctca
taaggaaagggacttctgggtcctttaaaaaaaaaaaaaaatcccacctcaatcccccag
GGCTCTCCTGCAGCTGCTGGAGAGAGAGATGCAGAATGAATGA
acttctggtttctggaggaggcacgggaagaaagattggaaactgactctgctagaaact
gctgttttggggatttttttcttccccttcatctccaccagaaacctgtcccttccctgg
gcaccaagagatgggctccccttgcctggcagagaaacagctggaaactggctccctgag

Exon  2 +       3556       4236   0     Single    681    92   Excellent
caagactgatttcccttccttttgcttgctctttgtcccttgggtgtcagactggtaaac
ccagcgcttcctacctggtggtcttcagcaatgcccatgccttccagagacgggggcctg
catcccagacaccaccactatggttcccacagcccttggagtcagctcctgtccagcccc
ATGGAGACGCCGTCCATCAAGGGCCTTTACTACCGGAGGGTGCGGAAGGTGGGTGCCCTG
GACGCCTCCCCAGTGGACCTGAAGAAGGAGATCCTGATCAACGTGGGGGGCAGGAGGTAT
CTCCTCCCCTGGAGCACACTGGACCGGTTCCCGCTGAGCCGCCTGAGCAAACTCAGGCTC
TGTCGGAGCTACGAGGAGATCGTGCAGCTCTGCGATGATTACGACGAGGACAGCCAGGAG
TTCTTCTTCGACAGGAGCCCCAGCGCCTTCGGGGTGATCGTGAGCTTCCTGGCGGCCGGG
AAGCTGGTGCTTCTGCAGGAGATGTGCGCGCTGTCCTTCCAGGAGGAGCTGGCCTACTGG
GGCATCGAGGAGGCCCACCTGGAGAGGTGCTGCCTGCGGAAGCTGCTGAGGAAGCTGGAG
GAGCTGGAGGAGCTGGCCAAGCTGCACAGGGAGGACGTACTGAGGCAGCAGAGGGAGACC
CGCCGCCCCGCCTCGCACTCCTCGCGCTGGGGCCTGTGCATGAACCGGCTGCGCGAGATG
GTGGAAAACCCGCAGTCCGGGCTGCCCGGGAAGGTCTTCGCTTGCCTCTCCATCCTCTTC
GTGGCCACCACAGCCGTCAGCCTGTGTGTCAGCACCATGCCCGACCTCAGGGCAGAGGAG
GACCAGGTGAGCGGCCTCTGA
tggcattcacggctccatcccgcagggtgcctgggcggagatgtcttttaggggcccaag
aaaatgtcttcagatcttaaaataagaagaaaaaaatgaatattatccaacatgggttat
attcattattaggccatcagtcataaaagataattttccatcttttttttttttattgga

Exon  3 +       7253       7372   1   Internal    120    69    Marginal
atttgaactcacctctgattggctctaaaatccgaccccctatgactacacaacactgat
accatctttctttcctttccttttcttttgttttctttcttcctaccctcgttttatttt
tcttcccttctttccttctctttctttctctctctctttctttttttaaatttgagacag
GATCTCACTTTATCACCAAGCTAGTGTGCAGTGGCATGATCTTGGCAGCTCACTACAGCC
TGCATCTCCTGGGCTCAAGTGATCCTCCCACCTCAACCCCCCAGGTAGCTGGGACTACAG

gtgggtgtcaccacacccagctaattttttgtattttttgtaaagacagggtttccccat
gttgcccaggctggtctcaaactcctgagttcaagcgatctgcctgccttggcctctcaa
actgccaggattacaagcatgaaccaccgtgcccagccctaactttcaattctgggccac

Exon  4 +       9923      10047   0    Initial    125    54    Marginal
caatcataacactattcagagggcggtgctgaggactgaacgagaacctgtatatcaggg
gccagcacagagtggacgcttgttgttctgctcccccttggggctgggctcacacccctg
gacctgctctgctgctctgctcaccagcctccatccctggctccctccaacctaatagca
ATGGCCAAGTCAGGGGCCGGTGGCTCAAATGTCCTCTCCATCCCCTTCCAGTGTCTGCCC
TCATTCCTCCTCTGCTCCGGCTGTCAGCGCGTCTTTTCTGAGAGCCTGCTCTGGCTGGAG
ACCCG
gtgggagaagcaggcgaactcgccacgcgcaggaccagccctgccggccttcccactgtt
ctcctcccatcttgggtgctacgcctgccccacagcattgcctggggctttcagggatat
tgtcagagggacatgcacaccctatggcaaccaagtaaggtgcccttggtgatgtctctg

Exon  5 +      17626      17695   2   Internal     70    64    Marginal
aatagttttaagccaaatttttctcttgtgcaatagtcccaaggtgagggatgtaggtga
gtatcgacaactcttattccagattctcccgccttgatgttccctcctcccctggggcgc
tggtccagtcctctcttcttagctgggttgcaggcccatttgtgctgtcccggctcacag
GAAGGATGGAAAGAGTGTGCAAGAGTTAGATCCAGAGGTGGTTTGCATCACTTCTGTTTC
CAGTCCGGAG
gtgaggacttagtcatatttggccacacctagcggcaagggaagccagaaagaacagtct
ctgacctagccgatctgctgtgtacccagccacaactggaaaactgtgtaaaaggaggtt
ctggtggacgactaagtttacagcacaaagctcatgggcatgaagtcgtcccccgatttc

Exon  6 +      17931      18734   0   Terminal    804    93   Excellent
agtctctgacctagccgatctgctgtgtacccagccacaactggaaaactgtgtaaaagg
aggttctggtggacgactaagtttacagcacaaagctcatgggcatgaagtcgtcccccg
atttccagcacagttgcaagtccactctctaccccgcgttgttgcctcttctccccgcag
GGCGAATGCTCTCGGAAGTGCTACTATATTTTCATCGTGGAGACCATCTGCGTGGCCTGG
TTCTCCCTGGAGTTCTGCCTGCGGTTTGTCCAGGCCCAAGACAAGTGTCAGTTCTTCCAG
GGGCCCCTGAACATCATCGACATCCTGGCCATCTCCCCATACTACGTGTCGCTGGCGGTG
TCTGAGGAGCCCCCGGAGGACGGCGAGAGGCCGAGCGGGAGCTCCTACCTGGAGAAGGTG
GGGCTGGTCCTGCGTGTGCTGCGAGCGCTGCGCATCCTCTACGTGATGCGCCTGGCTCGC
CACTCGCTGGGGCTGCAGACGCTGGGGCTCACCGTGCGCCGTTGCACACGTGAGTTCGGC
CTGCTCCTTCTCTTCCTGGCCGTGGCCATCACCCTCTTCTCCCCTTTGGTCTACGTGGCC
GAGAAGGAGTCCGGGCGGGTGCTGGAGTTCACCAGCATCCCCGCCTCCTATTGGTGGGCC
ATCATCTCCATGACAACGGTGGGCTACGGGGACATGGTGCCCCGCAGTGTGCCAGGCCAG
ATGGTGGCCCTCAGCAGCATCCTGAGCGGGATCCTCATCATGGCCTTCCCGGCCACGTCT
ATCTTCCACACCTTCTCCCACTCCTACCTGGAGCTCAAGAAGGAGCAGGAGCAGCTTCAG
GCCCGCCTCCGCCACCTCCAAAACACCGGTCCAGCCAGTGAATGTGAACTCCTGGACCCC
CATGTGGCCAGTGAACATGAGCTCATGAACGATGTCAATGACCTAATCCTGGAGGGCCCA
GCCTTGCCTATCATGCACATGTAA
ctcagcaccccccatgactacatggtaacctcaacccatcaccctgcctgaaacacactc
aagggtaccccgcatagaccacctggtggtgtttctagagcccagggaagactttcaaag
ctggaggggcataaggccacagaggctgtgtgtctgtgatccttgtccctcggggccccg

--------------------------------------------------------------------------------