--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (5591 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (4 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1203       1288   2   Internal     86    87        Good
tggtcctagcacttccatatattgattttcttttctggctgcttagtgggaggagtgtgt
gtgtatgcatgtgtgtgtgtgcgtgtgtgtgtgtgtgtacatgcctgtgtgtgtggatgc
atgcatgtgctgtgaagcagggagaccagctttccgctccttcttgttttctctctgcag
TGACCTGGGAGCTGTCATTTCCCTCCTGCTCTGGGGACGACAGCTTTTTGCACTGTACTC
AGGCAATGATGTCACGGATATTTCAG
gtcagtctttgagttgggtaggagcatgcatccctggcactgccacatcccactctgact
ctctcgggtctgcattctttctttgagaacacacagttccccattcttatcctgacctct
gggctttcaggactgccaagaacattggggatcctgccagaaatgaggggagcttgagct

Exon  2 +       1595       1696   1   Internal    102   100   Excellent
tcaggactgccaagaacattggggatcctgccagaaatgaggggagcttgagctttcgtt
ggcttctatttggggtagaaggagattgatgtgcagagcagcttccactcatctgacttt
tcatgggtctctgggaacaatttccaaatggtaaactctctggcttctctctctttgcag
ATGACCGCTTCCCGAAGCCCCCTGAGATTGCAAATGGCTATGTGGAGCACTTGTTTCGCT
ACCAGTGTAAGAACTACTACAGACTGCGCACAGAAGGAGATG
gtaagacctggacaactatctctgtgctctacctacaacccctgctctgacatttccatg
atgggtggtgctgaggtgatttgccagaaagttcgttgctctccttggagccaggagatt
tagattctgataagcgttttgtcgccagtagccatggccctttgggcagactaacttttg

Exon  3 +       2456       2530   1   Internal     75   100   Excellent
acttggcttccagcacagcactctttcccttcctccttctcgtattctctctcctttctc
ccttcctgtctgcctcctttcttcttcttctttttaattcttctccttaaatgccttctc
actctgctctgggtgcagacttgacttttcctttggctcatttcttgccttttgtttcag
GAGTATACACCTTAAATGATAAGAAGCAGTGGATAAATAAGGCTGTTGGAGATAAACTTC
CTGAATGTGAAGCAG
gtgggtgctgagcactgagcacttaagagagcaggcaggcgtccagcggggaacgtccta
gaggcacagccttccagtgcggcttcctctgagcacacaagagccaggaggagggatgtg
ggagaaccgcagctggccagggagagacttaagcagttaggtgatgactccctaaggatc

Exon  4 +       3614       4392   1   Terminal    779    86        Good
aattaaaaaaattattttaaaactgcaactattggaaatgagatcagcaggtggtaagga
caaagcatttaaatctttccagtttatgcagcagtgacagccgccaatgctttcacccct
ttctcagatggaaaggctcttgcacatttccactcacgagtgtcttgctctccttgacag
TATGTGGGAAGCCCAAGAATCCGGCAAACCCAGTGCAGCGGATCCTGGGTGGACACCTGG
ATGCCAAAGGCAGCTTTCCCTGGCAGGCTAAGATGGTTTCCCACCATAATCTCACCACAG
GGGCCACGCTGATCAATGAACAATGGCTGCTGACCACGGCTAAAAATCTCTTCCTGAACC
ATTCAGAAAATGCAACAGCGAAAGACATTGCCCCTACTTTAACACTCTATGTGGGGAAAA
AGCAGCTTGTAGAGATTGAGAAGGTGGTTCTACACCCTAACTACCACCAGGTAGATATTG
GGCTCATCAAACTCAAACAGAAGGTGCTTGTTAATGAGAGAGTGATGCCCATCTGCCTAC
CTTCAAAGAATTATGCAGAAGTAGGGCGTGTGGGTTACGTGTCTGGCTGGGGACAAAGTG
ACAACTTTAAACTTACTGACCATCTGAAGTATGTCATGCTGCCTGTGGCTGACCAATACG
ATTGCATAACGCATTATGAAGGCAGCACATGCCCCAAATGGAAGGCACCGAAGAGCCCTG
TAGGGGTGCAGCCCATACTGAACGAACACACCTTCTGTGTCGGCATGTCTAAGTACCAGG
AAGACACCTGCTATGGCGATGCGGGCAGTGCCTTTGCCGTTCACGACCTGGAGGAGGACA
CCTGGTACGCGGCTGGGATCCTAAGCTTTGATAAGAGCTGTGCTGTGGCTGAGTATGGTG
TGTATGTGAAGGTGACTTCCATCCAGCACTGGGTTCAGAAGACCATAGCTGAGAACTAA
tgcaaggctggccggaagcccttgcctgaaagcaagatttcagcctggaagagggcaaag
tggacgggagtggacaggagtggatgcgataagatgtggtttgaagctgatgggtgccag
ccctgcattgctgagtcaatcaataaagagctttcttttgacccatttctgtgttgtgtt

--------------------------------------------------------------------------------