--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (54863 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (14 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1350       1426   0    Initial     77    89        Good
cgcgctctccgtccgcagtggaagccgccgccgcgctcgcagcttgcaggcgccgcgtag
ccgtcgccaccgccgccagcccgtgcgccctcggcgcgtacccgccgcgctcccatcccc
gccgccggccaggggcgcgctcggccgccccggacagtgtcccgctgcggctccgcggcg
ATGGCCACCAAGATCGACAAAGAGGCTTGCCGGGCGGCGTACAACCTGGTGCGCGACGAC
GGCTCGGCCGTCATCTG
gtaggaacttttcattcgtctccacgccccgctccccgggctcgcgcggggcctcgtgca
ccgagccggcctccaggcgggacggattcgggcctcccgcgctgtcttcctcgccttatt
ccgggacggcgtgccaggcccccgcgggcttctccgtggccagcgcgtctgttagattgt

Exon  2 +       2652       2718   0   Internal     67    84        Good
tgtatacttaagatttgtgtgccttaggcacttccctgtggcttgtgaaccatgaaaaga
aagaccacgtggcaggcatcgccataaacccttcggtagtggcagaggctctgtgatgtt
ggtaatgggaccttttaaagagattggagaatgcgactccctcccatctctggtctttag
TTGGAAGCAAGCTTTCGGACAACGGCAGCACAGCCCGGAGGTTACGGCGTGGACCCTGAG
CCAGACG
gtgtgggttacttatttatttatttatttatttatttatttttgagacagaatcttcctc
ttttgcccaggctggagtgcagtggtacaatctcagctaactgcaacctccgtctcccgg
gttcaagagattctcctgcctcagcctcctgagtagctgggattacaggcgcccacgacc

Exon  3 +       4162       4256   2   Internal     95    65    Marginal
aaaaatgcttccctgctgtgtgtggatcctcatgaatgggccatgggagcttcagctgca
gtgctttctttccccagccatctgttggacaaatgcataggagaattatggttgccgtgt
ctgctcttgttcctctcggaaacgcttgttccttcctgtcgtcgtgtcctcataacccag
GGACAATGGACTCAACACTGGCACTGGCTGGATAGCAGTCACCACGCTCGACGTGCCTTA
TCTTGGTCATACCTCAGAACAGCCTGGTGTGGCAG
gtactaaggttactcctattctacagatgaggaaacggaggcccagagaggttaataggc
ttcctgcattcacccagctagaaagtggcagagttgggacttgaacccaggcaggctggc
tcggggcaggtgctcttggcttctgaggaggttgtttagattctcacctctcgtgggatt

Exon  4 +      10794      10899   2   Terminal    106    56    Marginal
tacaggcgtgagccaccccgcccggctgggtttttgtttttaagtggtaccctgaagggc
tgcgaaaacattacctttgtaattttctgcactatccagtctcccattgccttctttgcc
cacagatctgttgctgggaggccctgagccacgctgcatagcttttttgtgtgtccacag
GGGCGTGGGCTTTGTGGTAGCTCTTTCAGTCTACTGCATGGTGATGTTTGTGCTTTCTTT
TCTGTTTGTGGCTGTGTCACCACAAACAGAAAATGATGAAGGATGA
tagatgtgtatcttcctggtaagtacagtgtctcaagttcaaaaaaagcattccctaaac
actaggtgaattgggtttttgtcccttgaaaatattcagaagttaatgcaaactttttga
aagcatcccttacagattttataggtgttataaatacctccttgtctcccatcctttctt

Exon  5 +      11948      12110   2   Internal    163    92   Excellent
acccacaagtagaaattatccccacttcactgaggaggaacctgacattttccttggaga
gccagagtcgcttgctggagatgctgcagttgggaagaactgcactttgaatccagatct
gtgtccgaggctctcagctcttcccctgtgccgcgctggcctgccttcccgcttccctag
GCCTGTGGACTCTCTTCCCTCTGCCTGCACTGTCTTCATCTGTTTCGCCTTCCTGGAGGA
CTCCTACACACCCGTCAAGGCCCGGTGTGAATGTTCCCTCTGCTCGGATGCCCTCCTTGT
CTTTGTGGTGTTGGTGTCCCGTATGGTGGTCGTGTGCATGTCT
gtttcttcaactccttggcgaagtcctcctggagagagggactttgtccctttggtggtg
gtatccttggcggggaatccccatccttcatggttagatggctgccaatctctttccccc
atgggtgtgttgctcccttgagtgggcccaagtcatgggctgaatcctgggtcataggct

Exon  6 +      19109      19333   0   Terminal    225    48    Marginal
gtctcaaaaaaaaaaaaaaaaaagagcctttattcatgccctataaggaataaaccaaaa
ggagtttagaaataaacagagtaatgggtttcagtttttacactttttaatacttttgca
aagttttttgagcaggacaggagggtgtttttggtttggttttgtttttgtcaactgcag
GGAGTTACGAAAGTCACTCTGAAAAAAGACAGCAAGTGGTATAGTGATATCAGGCCTCTT
AGTAATGAGAGCTCTCCCTTCAACTTCAGCAACGAACCTGGCCCCTTCCAGCCCCAGCCT
CAGGCCCCCTCCCTCTTACAGACGTGGGCGGCCACTGAGCCCTCCTTCCTCTTTGGTGGC
AAGAAGACATTTCTCCTTCCCCAGCCTTGCCCTCTCTCCCCTTAG
cagcctgctagaagccagccgctgccatggcgactgcccagctgtccccttgctctgggc
agcaggatgtaagaattctttcccatttcctttcatcctcgctccagggagctccctcgg
tggaagctgacagctcagctttttggtgtgtgggttgttttttcccttcctgagccgtgt

Exon  7 +      29002      29166   1   Internal    165   100   Excellent
tgacaagggcagcggatgagtgcttccctcctgtcctctgcacatggtgctcccagggaa
ctgcaccggtctcctgctgtgctgctccaggcgcactcgtggctcacagcctctccccag
ggacatgacatgggggtgttttaacgcagcaccatgttctcttttcgcttttggccacag
ATGACGTCCGGTTGTTTGCCTTCGTGCGCTTCACCACCGGGGATGCCATGAGCAAGAGGT
CCAAGTTTGCCCTCATCACGTGGATCGGTGAGAACGTCAGCGGGCTGCAGCGCGCCAAAA
CCGGGACGGACAAGACCCTGGTGAAGGAGGTCGTACAGGTACTGA
gttcctccagagtctggaggtcaaagctcgccaagggtcaccatcctgcaaggagggaga
gggctgggttcgactcctgggtctgtagcttagctgtgacttgggacaagccatgctatg
tctctgcaccagtaaagccattggtgaaatgtcaccagaattgtttcaggatgctggcta

Exon  8 +      33320      33451   0     Single    132    47    Marginal
gctatggtggtccctctgggtcaggatcccagaagagagaggcctctttcctcagtgtcc
gtcaatctcttaagaggaccctgattggcccagcttgggtcacgtgcacacgcctttggg
cagggaggcggggtttcatgattggcagctccagcgtgatcccagttgttagagaaaggg
ATGCTGGTGAATGAAGAAGCGCAGATGTGCATTGCAGTGGGGGAGCTGGAATACTGGCCT
GAACTACAGGTGCAGGCTCATATTTTGACCATTATCATTTGCATTTTCCACCTCTCCACT
TACGAATGTTAA
ttatctgaagctgctacaagaccttacatttatactgcagttgcaaatatagccatttag
gtgacaaagggtccattctgctggtataatgctgtctttccacggccgctaaaaccatgc
agagactggcatgcctatcaacttcccctctgcttcacggggattcagagcggatgttct

Exon  9 +      35351      35425   2   Internal     75    78        Good
gcaggattgtggggacaatgcagtgaccgctggtagtgacctgcgatgtgccagggccag
gctctcttgatttagagccatgcttggtcagtgctgcatcatgcttgtcttgcaggatgg
gttcattcacctgatccttttattgattctttaacataatatgaacgttcacggagccag
GAATCCAGAAGGCATGCAGCTCAGCTTTCAGGAACAGAGGACAACAGAGGCTGCTGCCTC
CAAGGAGAAGTGGAG
gtgggaaggatggacgtgccagggatggtgtgaactagccaattggagtctattctgata
gcttctgagccccaggactaaccaggcttagtggcgcacacctgtaatcccaacattttg
ggagaccaaggcaggaggattgcttgagcccaggagttggagaccagcctggtcaacata

Exon 10 +      39199      39302   1   Internal    104    68    Marginal
acagtctcctaggagaaagaaggagatccctgcaccctaggtttgggcctggcatgtaaa
taaagccacctgaataagcaaagaattctgcccagcgggctgtgacctggctgccctcca
ccaaactccagaccagtgccagcccttggccagcctgccctagcctggtacctgccccag
GCACCTGCCAGCAGCTGGCCTCCGGACGCTGTGGTGCAGTGATTCCCGACACAGTCGCTA
GCACGGTATACAGTCGCTGTGCCGTGAGGATGCAGCATTCGAAC
gtgtacaggtcttaacctgaagaaatgaatctggagagctctttgtgtgtgaagtgcatg
tttcccagccttcatgaaaggccgaaggctcactgcactctacatcttgcccctgtgtat
gagtgtctttcctccccctcttctcttcctcttccctggaccactgcatacttttgtcca

Exon 11 +      48458      48615   1   Terminal    158    81        Good
ttggaagaggcaaaaaaggaaaaaaaaaaaaagcaggaatgagggaagactcaattttgc
acattctctctgtgttcccctgaggataaattggaaacgaaataggaatacaggactttt
aggtatgagccagttcagtgtgttaagacacttgctttctaaccctttgctttttggcag
TAATCGGATTGCTGGACGACTTGTCTTTTAAGACCTCTCTAAGTACTGATGATAAAAACA
GCCCTTCAACAGGGAAAATAACCTTCCATTCTATTTTCTACCGAGCAGAGAGGAAAGAAC
ATCAGCTGAGCCAGGAGGGTTATCAAGTTGCAGGATGA
ccctgtttatcttgtgagactcagtttgctttaaatgttttcagagatcatatggttgct
tttgtatatacttttgtttgtataacttggaatcatttttctgctaatcttttgatttta
aatatgtctctggtatgtagtacaaggtttgagggttttttttttgtagtttgaaacata

Exon 12 +      52309      52419   0   Terminal    111   100   Excellent
tgttcaatttccattgactctgctgctgaatttccattgactgactctgctgctgaattt
ccatttccatctctcatcagggttttcagtgctttgcttcccagtgtgttgcctgagcca
ccctcacatcctgtgccttccttcttaataggaacgctgtgttttcctttgttcttgcag
AATTTCGCTAAGGAGTTTGTGATCAGTGATCGGAAGGAGCTGGAGGAAGATTTCATCAAG
AGCGAGCTGAAGAAGGCGGGGGGAGCCAATTACGACGCCCAGACGGAGTAA
ccccagcccccgccacaccaccccttgccaaagtcatctgcctgctccccgggggagagg
accgccggcctcagctactagcccaccagcccaccagggagaaaagaagccatgagaggc
agcgcccgccaccctgtgtccacagcccccaccttcccgcttcccttagaaccctgccgt

Exon 13 +      53727      53757   1   Internal     31    59    Marginal
tttctgtttttccttgctcatttcgttttggggaagaaatctgtactgtattgggattgt
aaagaacatctctgcactcagacagtttacagaaataaatgttttttttgtttttcagaa
aacagtttggtttctgatttgtcctacaaagttctttttttttttttgctgtaataacag
AGGCAGTCATCATCGCCTTCAGATTTAATAG
gtgtttgcggagctgctgaggcggggcacattcacattcaattgcttatttaattcttag
caaccataagaaacaggtgctgcttttgtccccatttcctgaaatctgaggctcagaggg
attcattcacccgaggtcacccagatagaaagtggcagagctgggatttttttttttttt

Exon 14 +      54374      54469   0   Internal     96    66    Marginal
tgggattacaggcgtgagccaccacacccggccagagctgggatttgaactgagatctct
caaagtccctggtgctgtggcttgtgaggggagcggggaggccacacatttgggatagcg
atgggaccacaggtagtgattctttttgagtggccagaactcccctgtctgcctgtttag
GAAAAGCCAAGAGAAAGCATCTTCCTCGTTGGCCATGACATCCTTTCTGAGGTTATCCTA
CAGCTGAGAAACTGGACTTCCAGCACACCAGACCCT
gtgggagcccagaatcagggcagaggagtttcagacacagacagcggggcttggaggagc
tgagtgtggggcagggagagtgcggagagagggcagaagccgaaatcagggcaggaagga
atcctacaaggtatgggcaaggccctgatcatgctgcccagggtggcagggggccatagg

--------------------------------------------------------------------------------