Gene TGM7 Variant 1
DNA : 17.35 KbNT_010194
mRNA : 2298 bp NM_052955
CDS : 2124 bp NP_443187
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  184 bp
ccccgcacacacacacccgcacgccccccccgcacaccccacctccccccccgcacgccc
cacctaccccccgcacgccccaccacccgccgcacctcccagaaatgactgagaagccac
aagggatgcctgagcccaggggactgcaggtgggcgtgacctgtcccctcctctccccta
GTGGCAACCTTGCGGCTTGAGTCTGTCGACCTGCAGAGCTCCAGGAACAACAAGGAGCAC
CACACGCAGGAGATGGGCGTCAAGCGGCTCACTGTGCGCCGCGGCCAGCCCTTCTACCTC
CGGCTGAGCTTCAGCCGACCCTTCCAGTCCCAGAACGACCACATCACCTTTGTGGCTGAG
ACCG
gtgagtttgccctgtcccaaggccccgcaggttccgtcaaaatgagggcatttacagagt
ctgcctgcggggcccctgcctttcccacctgagctgccctccactttcttgtcctgggag
ccccagacccctcatgctcaggaccctgttagtgctgttaaggagagatttggtcaactc
EXON 2  246 bp
acagattaaaaaacggaggcctgggggtcttaaatggtttgcctgaggacactcggtggc
agtaaaagccaaaagcattagcaggtggtgggagaaggtgacggtccttccgactcccct
ggaatcatataccatacaggttttttgagcctcactgtggggtcattctctcctacacag
GACCCAAGCCGTCAGAGCTGCTGGGGACCCGAGCCACATTCTTCCTCACCCGGGTCCAGC
CCGGGAATGTCTGGAGCGCTTCTGATTTCACCATTGACTCCAACTCTCTCCAAGTTTCCC
TTTTCACACCAGCCAATGCAGTTATTGGCCATTACACTCTGAAAATAGAGATCTCTCAGG
GCCAAGGTCACAGTGTGACTTACCCGCTGGGAACTTTCATCCTACTTTTTAACCCTTGGA
GTCCAG
gtaggatgtgcccacagcttgtattgctaacctgatccattgggaaggccctgtgaggtt
ctttggaaaaagcccagaaaataaatcgccacatagctatgcaatgtagtagcgtgtgct
ctcacaaaaatcatctttacaaagaatttctaatggcatgaggaaagtattcatgacgtg
EXON 3  119 bp
tggcttctagaaaagcacatagtagacctttaagggggtctagtcttaatttctgttgct
atcaacccatcgactgttcctcctgttttccagaaacacgttgtcgttactgttttttaa
tttaatactctgtttttttggtttggggttttgccccctccactactcttaactgctcag
AGGACGACGTCTACCTGCCAAGTGAAATACTGCTGCAGGAGTATATCATGCGAGATTATG
GCTTTGTTTACAAGGGTCATGAAAGATTCATCACCTCCTGGCCCTGGAACTACGGGCAG
gtaacactattacccaatgtgggcctggggtgggctccctaaggctggtccttacacaac
cctgttatgtaaggctgttatattacacagccctcatagagggccactaatacaggcgag
ggtgtgaggggcttggccagcttcacatccagtgagaggggcaaggaaggaaggggtgga
EXON 4  129 bp
tacattcccaatttgatttataagctcttcaaaggcaggaacttgtcttatatttagcgc
cctccccctgcccccacatccccatatacatgccatccccaaaagtctgttagtgactta
aagtttcagaagtctagacatttgctcttctcttttttctcccttaaaatcacttggaag
TTTGAAGAGGACATCATAGACATCTGCTTTGAGATCCTGAACAAGAGCCTGTATCACTTA
AAGAACCCGGCCAAAGACTGTTCCCAGCGGAACGACGTGGTGTATGTGTGCAGGGTGGTG
AGTGCCATG
gtaaggatggatgcttcccgccgtctgaggacagtctgagcttccccgggagctgtggaa
acccacctgtctgtcctctgcagatcaacagcaacgatgacaatggcgtgctgcagggga
actggggcgaggactactccaaaggggtcagtcctctggagtggaagggcagtgtggcca
EXON 5  178 bp
gatcctgaacaagagcctgtatcacttaaagaacccggccaaagactgttcccagcggaa
cgacgtggtgtatgtgtgcagggtggtgagtgccatggtaaggatggatgcttcccgccg
tctgaggacagtctgagcttccccgggagctgtggaaacccacctgtctgtcctctgcag
ATCAACAGCAACGATGACAATGGCGTGCTGCAGGGGAACTGGGGCGAGGACTACTCCAAA
GGGGTCAGTCCTCTGGAGTGGAAGGGCAGTGTGGCCATCCTACAGCAGTGGTCAGCCAGG
GGCGGGCAGCCTGTGAAGTACGGACAGTGCTGGGTCTTCGCCTCTGTTATGTGCACCG
gtgagcgaaagatcactcacttaggggtgtgattaacttcattatcagagaagttaactg
tggctcataaaggttcagtagcttgcccatggccccacagctgggggtggtgggcaccca
ggccctgagctagcacaccatacagtctcgagggatcctgtgcatttatgtgagaggggg
EXON 6  139 bp
ctgatggggcagcagggctgtgggactgggtgtggggctctgggaataaaggagttactg
gtgtggttccgtaagcgtcttggctttctctcctccagcttgaaagttacaaattatgca
tggaaaaccaataattctgcctgaaatgaactcagcgattctctatatttttctctttag
TAATGAGATGCTTAGGTGTTCCAACCCGTGTTGTTTCCAATTTCCGTTCCGCGCACAACG
TGGATAGGAACTTGACCATCGATACGTACTATGACCGAAATGCCGAGATGCTGTCAACTC
AGAAACGAGACAAAATATG
gtgagaggcactgtcttgaacagatctctgctttgtcccagggagggcagaaaaactgac
ctggttctctctggctcttgaggaaatattgcaagattgccctgagcattgctgctaatg
ctcagagaagagaagaattccccaacccaggaggctgttctggctaattaggtcatcaaa
EXON 7  104 bp
gggattacaggcgtgagtcaccgcgcccagcctgtactattcttgtgacttttagtatga
aattacttcctaataaaaagtaagaaaaagaaacaatgatataaatcactccgtatagtg
cctggtacctggcaaaacctcagctaacatgaatccttgtctccttactccctcctgcag
GAACTTCCACGTCTGGAATGAGTGCTGGATGATCCGGAAAGATCTCCCACCAGGATACAA
CGGGTGGCAGGTTCTGGACCCCACTCCCCAGCAGACCAGCAGTG
gtgagtgaggaccattgcaacaggctctggctctgtggggaggcagattagggtgactgg
ccgtgggagcaggagaccagggaggagcagcgttttccacggcaccctcttcccgaggtc
ccagctgacacagcttcagatcaggaatctaactctaccattgacagagtcacccggatg
EXON 8  243 bp
ttgccacttcacagggtggctgtgagggtcagatgaattaatgggaacaaaagtgcttgg
taaactggaagatatcccacgggtgagagtcagtggtgccgctgcctatcccatctccac
ctcccacagccacaaccagctgcccctggcccccatatcagtagcctgttgcctccacag
GGCTGTTCTGCTGTGGCCCTGCCTCTGTGAAGGCCATCAGGGAAGGGGATGTCCACCTGG
CCTATGACACCCCTTTTGTGTATGCCGAGGTGAACGCCGATGAAGTCATTTGGCTCCTTG
GGGATGGCCAGGCCCAGGAAATCCTGGCCCACAACACCAGTTCCATCGGGAAGGAGATCA
GCACTAAGATGGTGGGGTCAGACCAGCGCCAGAGCATCACCAGCTCCTACAAGTACCCAG
AAG
gtgctgggcgggtatttggggaaagggctgctttaagcttctttgtgatgcttcctagct
gggatggctccaagttgaaaccatcaccatcgaatcacctcttcctcatggcaaactcct
aggggtccttcctggatcccaggcatgtggccctagggtagggttaccagcaaataaaaa
EXON 9  327 bp
acagaacagaacactgagagattaaaggactgtgacagagcaaggatttgaacccagcaa
gcagcacctgagccgcgccgcctccctgtgctgctattcctgtgccttgttgccccagga
aagtcactggtcctctccacccctccccatgcatgtctctcctacctctcccttctgcag
GATCCCCTGAGGAGAGAGCTGTCTTCATGAAGGCTTCTCGGAAAATGCTGGGCCCCCAAA
GAGCTTCTTTGCCCTTCCTGGATCTCCTGGAGTCTGGGGGTCTTAGGGATCAGCCAGCGC
AGCTGCAGCTTCACCTGGCCAGGATACCCGAGTGGGGCCAGGACCTGCAGCTGCTGCTGC
GTATCCAGAGGGTGCCAGACAGCACCCACCCTCGGGGGCCCATCGGACTGGTGGTGCGCT
TCTGTGCACAGGCCCTGCTGCATGGGGGTGGTACCCAGAAGCCCTTCTGGAGGCACACAG
TGCGGATGAACCTGGACTTTGGGAAGG
gtgagtgtgaggcaggcctgagaaggcacctacagggaggggagctgtgggtccatgaac
acagtggggtgggcccagccagattacacacagaccccttcctccaacacacacacattc
tgggcagtgaagctgccagctgctgcacctctgatgccaccccaccaggcgagacggagc
EXON 10  161 bp
ggcgagacggagcagtgagccctggggacagtgtgtgcgtggtgggacgctgtctgtctg
tctctcacacacacttttacctctcacgtgaaaattctaatttttcctctctcacatcta
catgtcccccctctctctggtccatgtcctggactcaaggtgtcttttgtatgtgcttag
AGACACAGTGGCCGCTCCTCCTGCCCTACAGCAATTACAGAAACAAGCTAACGGACGAAA
AGCTCATCCGCGTGTCTGGCATCGCGGAGGTTGAAGAGACAGGGAGGTCCATGCTGGTCC
TAAAAGATATCTGTCTGGAGCCTCCCCACTTGTCTATTGAG
gtagtgtctggacatgggtgggggctctgaggctctctgactcacccaatccaggggctg
gggtgcagcagccaacaagacactgttcccacctctcaccacaccgatggctccagcaca
gtatggtgtggtctagtgctctgtaccagcgtggggttggaggggcatgaaggcttctca
EXON 11  134 bp
ggcctgtatatgtgttaatctcaagtactctcagctcacattcctccctcgccactgtgg
cacattagctctaagccgcagttcctggtggtcgccagggacctgggggtgggggtaact
gaaccagagtgcagaagcgaggccagttgcccatgggattgctgacttctctccacacag
GTGTCTGAGAGGGCTGAGGTGGGCAAGGCGCTGAGAGTCCATGTCACCCTCACCAACACC
TTAATGGTGGCTCTGAGCAGCTGCACGATGGTGCTGGAAGGAAGCGGCCTCATCAATGGG
CAGATAGCAAAGGA
gtaagtgacgcttctgcccacctcccccttgctggtctcaggaaaggggtgccccatggc
gtcacaggaccctcctcagtctcctgtgcagtgcctctctgcccccactttctcaccctc
ctcaggaaaggctgagctcagtggtggtggtgagtgggagcctcttacccacccagaggg
EXON 12  334 bp
gaccctcctcagtctcctgtgcagtgcctctctgcccccactttctcaccctcctcagga
aaggctgagctcagtggtggtggtgagtgggagcctcttacccacccagaggggaaccag
atcacccctgccgccagcaggaagtcctcgaggctctcacaggctgtttctgactttcag
CCTTGGGACTCTGGTGGCCGGACACACCCTCCAAATTCAACTGGACCTCTACCCGACCAA
AGCTGGACCCCGCCAGCTCCAGGTTCTCATCAGCAGCAACGAGGTCAAGGAGATCAAAGG
CTACAAGGACATCTTCGTCACTGTGGCTGGGGCTCCCTGAGACCCGCCCTCCAGCTGCCC
TCCCTGGCACCCCTGCCCCACCTGGCTCCTTTCTACTCCTGGCTATGTCGTCTTGGCTCC
ACCTCTGTCCTCTCTCTAGCCTGCCTGGGAATGAATGAAGCTCTGTTAGAAACACCGTGT
GCTTTGGGAAGAGACAATAAAGATGTCTTTATTT
atcaccagcattctcaagccacttattgctcctggctgatcctcttggcctggctgccag
ctctgtggctgaaccctcccttcccctcctgtcctctctctcctcccttaagagcctcaa
ccacaaaataagcccaccaccatcccctctaaagcagcctctctggaattaaggatccca