Gene RPS27L Variant 1
DNA : 3.62 KbNT_010194
mRNA : 503 bp NM_015920
CDS : 255 bp NP_057004
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  78 bp
gcccgttagacccacgggacttggcaccctggaacgctcaccatccccgggtcttccctg
cgccctggacccgagtaccctgctgcggcgtccccctaccaccgagaggagggcctagag
cagacaagcccgccccgccgctcctcccagcagcttctatcccggaagttgatgccgagc
GCAGATCGCTTGCAGCTTGCTAGCTGTGTGGGCTGGGAGGTCTGGTAGGGCTGAGCTTGC
AAGAGGATCAACATGCCT
gtgagttgtttacatcgggctccgggtttgttttgggcttctttaccgagagtcatatgg
gacggatgagtccggctgcctctcgggcctgtagtgtccgagagtggcgaggcggctcag
gttgcgcagcgtcttcgcgcgtggcgggcatgtagtgacttgcccggtcaccgcggcgcg
EXON 2  109 bp
tattatgaaaagtactgatgaaagttattaacaggtttcgaaaaataactttactatctg
acgtgttgcttctgccgaggatgaccgttattcctgtttttgcatgtatatttcacgtat
ggttaaatgtgccagcgttgtggtttaaaactaatagtaataatatgcttctttgttcag
TTGGCTAGAGATTTACTACATCCGTCCTTGGAAGAGGAAAAGAAAAAACATAAAAAGAAA
CGCCTAGTACAAAGTCCAAATTCTTACTTTATGGATGTAAAATGTCCAG
gtaaaatttgaaatcttaattcctttactaaagaaaatttctgtagggattgctagtgtg
gtgtgtatagttaagatacattagaaccctctgttgagtagaagtgggattacagaattg
gaaatgtcagggacattttcataataaatgtactgaaaccattgtagaaacatttcgggg
EXON 3  111 bp
tattgattttacctgtttttaaaaaattttgtgtcgctgctagaaaagtttatgttacac
atgtggcttgctgtttcatagcactgaagttactgatttttttacatattaccagaaatg
tcgaacaggtgctgttttcctctgcttttcatttttaacattgcctttttttttttttag
GTTGCTACAAGATCACCACGGTTTTCAGCCATGCTCAGACAGTGGTTCTTTGTGTAGGTT
GTTCAACAGTGTTGTGCCAGCCTACAGGAGGAAAGGCCAGACTCACAGAAG
gtatatcatttggcattctccaacccagtgatgagattgatgattataaatgtctctatc
ttcactgaaaagtttaaagaaatcttaatgattaccaaaataacttatctttcattgtgt
gctttcagtaaagaatggcctgttcaaatggatatatttatactcttgaccttgcagtga
EXON 4  205 bp
ctcagatatgatagatgtattatagcaaatttctggtataaaaggataaataatctgtat
atgagtattaatccaatattcttaaaacttcagtattttacttaaaagtactttttgtca
ttaaaattatagcaaaggtagaatgcacttgtttaatatactctcatgattcttttgcag
GGTGTTCATTTAGAAGAAAGCAACACTAATGATTCAAACAGCTTCCTGAATTTTAATTTT
GTGTTGTCTCACAGAAAGCCTTATCATAAATTCCATAATTCTAATTAATTTACCAAGATA
ATGTAATTACATTTGGTTTTGTAAGGTATACAGCAGTAATCTCCTATTTTGGTGTCAGTT
TTTCAATAAAGTTTTGATTATGGGC
aaatcccctctttttctttttttaaaatatatttgagtatgccatacatttatatatatg
gtgtatatgaatttggtttaaacattttaaaatttattctgattagtttgtgtctttttt
tttttttttgagagagagagtcctgctctgtcactcaagctggagtgcagtggtgcgatc