Gene RPS17 Variant 1
DNA : 3.70 KbNT_010194
mRNA : 481 bp NM_001021
CDS : 408 bp NP_001012
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  28 bp
ggaggagccgtcgggggcgggacagacaccctgcccaccggaggggcgcgccaccgccgc
ccccgctccactccgccagggggcgctgtgtggctcccgagtaggctcagagcgaccgtg
gccgggcggaagcggctttctggcctaagctttaacaggcttcgcctgtgcttcctgttt
CCTCTTTTACCAAGGACCCGCCAACATG
gtaggtgttttggctcgaggccgccatcctccacaatcgtcccccatctgcagcttcccg
cggtcctcagcccacagagaggccctgggccgggaaggcgcagagccctgtcaggctgga
gcgcaacgggccggcggcttccgcattaagcccggcgcccggcactgtttagccgggccc
EXON 2  152 bp
ggctggagcgcaacgggccggcggcttccgcattaagcccggcgcccggcactgtttagc
cgggccctctccggctcagcgcagccggcggtccccaaccacaccggccggggctcggcg
ccgcactcttcccagaaggttgcgctggctcgtgagtgatcctgtcctctccacccgcag
GGCCGCGTTCGCACCAAAACCGTGAAGAAGGCGGCCCGGGTCATCATAGAAAAGTACTAC
ACGCGCCTGGGCAACGACTTCCACACGAACAAGCGCGTGTGCGAGGAGATCGCCATTATC
CCCAGCAAAAAGCTCCGCAACAAGATAGCAGG
gtgagtcgggccttcctcggcctccggggctccgcgatctgtttgtgtgctctgccgccc
tccgactcgggaagagacggtgccttggtggtttcgttagcctgagactccctggtgtcc
cggagaagggctagagctctgcgtgtgcaggatttctgttgtgaacttaggcctgtgtca
EXON 3  106 bp
gggaaggaatgctcaggccagtggaggttctatgtgtaggaggtcccaggatagtgagtc
ctcttccttctcactgtggaaaagaactaaagcgggtatttatatatgcacatgtgctca
gtaccaggtgggagttgatttgtcttctcactgttctctttggctgtgtgtgctttgtag
TTATGTCACGCATCTGATGAAGCGAATTCAGAGAGGCCCAGTAAGAGGTATCTCCATCAA
GCTGCAGGAGGAGGAGAGAGAAAGGAGAGACAATTATGTTCCTGAG
gtaaactttctggatatttgggcttctggctaatcctcaaatgataaagctatgggttct
tggcttccaaagggacctcagctgaatctgagacctttaatccatacattccataaccag
ctgtgggtgcccataggccccctaccagtttcttagcctccattctgctcttctggaacc
EXON 4  66 bp
aaggccagaagaacaggtcatcggggtctgtaatactgtaagagactgctcaccttgtga
gaggaatgctatccttgtgcagctcctcttccccatatttaagaacctggggagaggagg
aggagaggtgagtgataatctcattgattggtattttgaccctacctcgtttccttgtag
GTCTCAGCCTTGGATCAGGAGATTATTGAAGTAGATCCTGACACTAAGGAAATGCTGAAG
CTTTTG
gtaagtgtttgctggattcctaaagtggtattttcctggtcaaaaaccatcagtaggtct
tattatccaaggtcacccagctagtaagtggcagagttgggaatcccatctaaacttgta
gccactaaactggactgctttcataaggggtgtagcggaagttgtgtgcattgagttagt
EXON 5  129 bp
aaggaagatcactctggaaaagtgggaggcattgagaaccctgttggctcttaaagggtc
cttcaggtcgcctctggacccccttgagagtgctgtggctctaggggcctgtgttttctt
ctggggtccactcacagatctcaccagtaactgctcactgaatccattttctcgttccag
GACTTCGGCAGTCTGTCCAACCTTCAGGTCACTCAGCCTACAGTTGGGATGAATTTCAAA
ACGCCTCGGGGACCTGTTTGAATTTTTTCTGTAGTGCTGTATTATTTTCAATAAATCTGG
GACAACAGC
cttgcctgtgtcatctttgcagttgtgtgtgggtagaggaaaggcaggagctctcgaggc
aacagatcagctggcacttgtctgggattcaggtgctgctgcatctggtttatggggagt
gggttcaccagagtttagtaaaggagcaagggcaagcctgaacgtgttgagagtggtctg