Gene MKRN3 Variant 1
DNA : 2.77 KbNT_026446
mRNA : 2772 bp NM_005664
CDS : 1524 bp NP_005655
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  2772 bp
gggttggtccccgcctgtgtgaacgaaaaaatatgtcagattggaaaattgcggtaaaaa
ccaggcagagcacgtacgttgcccccacaggaagtgtccgccatgctgcctgtgcccgga
agtaggtaggaacacacagtcagagggacccaaaagcaggggggaaggaaaaagagatgc
ACACTTCCCCCAGAGAAGCCTCCGAGCGCGGCCGCCATTCCGGGCCTCAAGCCCATAAAG
AAAAAATACCGGAGAGGTTCTGGCACCATTTCGGGGTGCCAAAGCAGCCATGGAAGAGCC
TGCAGCTCCCTCAGAAGCCCACGAGGCAGCCGGGGCCCAGGCAGGTGCTGAGGCAGCAAG
GGAGGGTGTGTCTGGGCCGGACCTTCCCGTCTGTGAGCCCTCCGGGGAATCTGCTGCTCC
AGATTCAGCCCTGCCACATGCGGCAAGGGGCTGGGCCCCCTTCCCTGTAGCTCCAGTCCC
TGCCCACCTCCGCAGAGGAGGCCTGAGGCCTGCCCCAGCCTCAGGAGGAGGAGCCTGGCC
CAGTCCGTTGCCAAGCCGAAGCAGCGGCATTTGGACAAAGCAGATCATCTGCAGGTATTA
TATACATGGGCAGTGCAAGGAGGGGGAGAACTGTCGCTATTCGCACGACCTTTCTGGTCG
GAAGATGGCCACTGAGGGTGGCGTTTCGCCGCCTGGGGCCTCTGCAGGTGGAGGCCCTAG
CACGGCTGCGCACATCGAGCCCCCGACTCAGGAAGTGGCGGAAGCCCCCCCGGCTGCATC
CTCCCTTTCCTTGCCTGTGATTGGCTCGGCTGCTGAAAGGGGTTTCTTTGAAGCCGAGAG
AGACAATGCAGACCGTGGAGCTGCTGGAGGAGCAGGTGTAGAAAGCTGGGCGGATGCCAT
TGAGTTTGTTCCAGGGCAGCCCTACCGGGGCCGCTGGGTTGCATCTGCCCCCGAGGCTCC
TCTACAGAGCTCAGAGACTGAGAGGAAGCAGATGGCTGTGGGCAGTGGGTTGCGGTTTTG
CTATTATGCTTCCAGGGGAGTTTGCTTTCGTGGGGAGAGCTGTATGTACCTCCATGGAGA
CATATGCGACATGTGTGGGCTGCAGACCTTGCACCCCATGGATGCTGCCCAGAGGGAAGA
ACATATGAGGGCCTGCATTGAAGCACACGAGAAAGATATGGAACTCTCGTTTGCTGTGCA
GCGTGGTATGGACAAGGTGTGTGGCATCTGCATGGAGGTTGTCTATGAGAAGGCCAACCC
CAATGACCGCCGCTTTGGCATTCTTTCCAATTGCAACCATTCCTTCTGTATTAGGTGTAT
CCGCAGGTGGAGAAGTGCCAGACAGTTTGAGAACAGGATCGTCAAGTCTTGCCCACAGTG
CAGGGTCACCTCTGAATTGGTCATTCCCAGTGAGTTCTGGGTGGAGGAGGAGGAAGAGAA
GCAGAAACTTATTCAGCAATACAAGGAGGCAATGAGCAACAAGGCCTGCAGGTATTTTGC
GGAAGGCAGGGGTAACTGCCCATTTGGAGACACATGCTTTTACAAGCATGAATACCCTGA
GGGCTGGGGAGATGAGCCTCCTGGGCCAGGTGGTGGGTCATTCAGCGCATACTGGCATCA
ACTTGTGGAGCCTGTGCGAATGGGAGAGGGCAACATGCTCTATAAAAGCATTAAGAAGGA
GCTTGTCGTGCTTCGGCTGGCCAGTCTGTTGTTTAAGCGGTTTCTTTCACTGAGAGATGA
GTTACCCTTCTCTGAGGACCAGTGGGACTTGCTTCATTATGAGCTGGAAGAATATTTCAA
TTTGATTCTGTAGCATCGTGCTGTGGCATGTGGTCTAGTCTGCTGAGGTTCTGTCGTCTG
CTATTGCCTGTTTTCCCTGTGTTGACACTCTTACTGCTTTCAGGGGCTGTTGAGGCAGTG
CTTCTGTTTTCTTGTCTATTCTGCATATCTTTCCCCCTAGGATTATGGTGATTATCTGTG
TTAAAAAATAAGTCCTTAAAGTTACTGTTTTGGTGAAATTAATATTAATGTCAGCTTATG
GCTTTTTTTTGTCATCTCTGTTGTCAACAGGATTAACTCAGTTCTAGTGTAGTGTTTACT
GAATTTCCACACTTATTTTGAAGACCCTCAAGAGTAAATGTGGCAGAGTGAAAGGAGAAG
TTTTAATTGAACTAGTAGCTTTGTGCTATAATAGCCTTAACAAATGGACCCTTGCAGGGC
TTTGCAGCTGCTCATCTGTTTGTTTACAGTTTGTTCTTTCCCTCCTTCCCCTTCAAGTGC
ACTTGTTAAACTGTGATGAACTTGTGATTTTGTGTTTTACTTGACCAAAACCAAGTGTAT
ATGTTTACATGTTTTTATCCTGTTTAGCTTGACATGAAATAATTTATATTTGGAAATATA
TATTTAAGAATTATATATATAAAAATATATATGTATAAGAGTTATGTATTTGAAAAAAAT
ATATAAAAGAATATACATCACAATATAATATTTATGTTTATGTAATAAAGTAAATACAGA
GCTGAAAGCTGAAGGTCAAAGCCTAACAGGATTGGCTGTTGTGTGGATGTGAGTTGTGTG
AATAATCTTTCTGTCCCTCGCACAGAAGCCAGTAATTAGCATCTAATGAAAAGGACTGTT
CAAGTGGGTCTGGCCAAATGTGACAGATGCAGATCTTAGAGGACTTACAAAGCACTATAT
TGGTAATTCTTACAATGGCATTAATAGCTTACTCTATAAATACAGAAATGGTTTTCCTAT
GCAGTTTAGCCACCTTCTCATTAATTCTTTGTAACAGCAAATCCTAGGCTCAGAGGCACA
GTGCTTTGTATTTGATATACAAAGTCTCTAGACTTTCCCAACAAGGGGCTTTTGACAAAA
GAGTTCAACATAAAAGTAACAAGATTATAAAAGGGAAAATAGAACAAAAATATTAAAACC
AATGAGAATAAA
agaatggaaagataaaataataaaatatagaaagcactaaaaactaagtgtaagactaat
atagaaaatctacatacaacttaattagattaaatgaaagcagtttaaagactgaaagtc
aaaggctataagacttcattacaatcagaatgaaacatcctgtttaaaatacacacaaca