Gene MEF2A Variant 1
DNA : 115.33 KbNT_035325
mRNA : 2953 bp NM_005587
CDS : 1524 bp NP_005578
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  55 bp
aaatgactttttaaaatttaattttcatttaacagtatttgtggagctttctgctaggaa
tggtgttgagtgctagaattttgtataatgtatatttaattcagctttggagtcaagaac
aataatgcatctcaaatttttttcttttttaaggaattgcattttgtgaaaaaagaacaa
GAATTTTCTGCAAGGATCATATCTAAGTGCACTTTTTGCTGATACTTCATTTCTA
gtaagacattttttcttttctatgttaagtagatacaatggaaatgtattttaaaaatca
ggctgttcttgtgagattgaatggcagttattttagaggttttcttgggggcgagggggg
cttaatttagacccagttgaggaaatttgtaaaattcggttgaaatgcgtaatattgtgt
EXON 2  217 bp
tttgggtatatacccaataatggaattgctgggtcaaatggtagttctgttttaagttct
ttgagaaatctccaaactgctgtgcacagtggctaaactaatttacattctcagcaacaa
tgtgtaaatattccccttgctctgtaacctcacaaacatcttttttttttttttttttgg
GACATTGAGTCTCACTCTACCCCCCAGGCTGAAGTGCAGTGGTGTGATCTCGGTTCACTG
CAACCTCCGCCTCCAGGTTCAAGTGATTCTCGTACCTCAGCCTCCCGAGTAGCTGGGATT
ACAGGCGCCTGCCACCATGCCTGGCTGATATTTATATTTTTAGTAGAGATGGAGTTTCAC
CATGTTGGCCAGGCTGGTCTCGAACTCTGGACCTCAG
gtaatctaccctcctcggcctcccaaagcgctgggattacaggcgtgagccactgcgcct
ggccagcctcaccgatgtctatctacagaatatttaataacaaaactagaactacatttt
tcctacccacaacaatacattgtgaacatttattgtacagtgttccacctttttaatggc
EXON 3  196 bp
tcaagaggtattttaggggtaaagttaacaagacttcaacttatttactaattttgtata
accagaaatttcaactaataatgctgtgtgcagtgtaaaagcaaatttgaaatttgtata
acacttacatgatttgtaaacttacagattttaaatcttctaatttgtgttttcttttag
ATCTTGTAGAAAATTTCAGCTGTAGCCCTTGGACTAGAAGCTGAAATAACAGAAGCTGTG
TACGATGCATTAGGGTATTGAAGAAAATTAACTTTTGAATTAAATATTTGGAATATAAGG
AAATAAGGAAAGTTGACTGAAAATGGGGCGGAAGAAAATACAAATCACACGCATAATGGA
TGAAAGGAACCGACAG
gtaaatgaaaattttaatttatttaattgatatgaatattcttttaaaaaaagaacatag
gacagaatggttgggtttttcttaaacttaattttaagtctaaatatttttagttacaga
ctaaatgaaaaattctaacaatcataaaattgtatcttttcatcatctgctttaaagaga
EXON 4  204 bp
caaaacaaatgtaggactgtagcacaacaggagagggaaggctcatatggaggacaaagc
tgggaaccttttccatctttgaaatctggctcagtattaagaagaagattcatcttcaga
tagcccatattcaagtactactaatgcttttaataaaaatataccttttttattgtttag
GTCACTTTTACAAAGAGAAAGTTTGGATTAATGAAGAAAGCCTATGAACTTAGTGTGCTC
TGTGACTGTGAAATAGCACTCATCATTTTCAACAGCTCTAACAAACTGTTTCAATATGCT
AGCACTGATATGGACAAAGTTCTTCTCAAGTATACAGAATATAATGAACCTCATGAAAGC
AGAACCAACTCGGATATTGTTGAG
gtaacacatatctagtaatacgtgaattgcaagtaatactgaaatattttgtttaatagc
attaactgtcagaatgacttgtacatctaaaacataaattaggtgtatatgtatcttttc
tctaaatcatttcttagaagagtgattgctgtatggcgactcacttgtgttataaacata
EXON 5  138 bp
ccttaatggttgtgagagccctgatgctgacgattactttgagcacagtccactctcgga
ggacagattcagcaaactaaatgaagatagtgattttattttcaaacgaggccctgtaag
tacttttactttacctctactttttatttgttgatcctttttgttaacttcattatttag
GCTCTGAACAAGAAGGAACACAGAGGGTGCGACAGCCCAGACCCTGATACTTCATATGTG
CTAACTCCACATACAGAAGAAAAATATAAAAAAATTAATGAGGAATTTGATAATATGATG
CGGAATCATAAAATCGCA
gtgagtactaaagtatggtttgtgcttttatcttgtgcatgaagagattgaccaaacatc
ttgttgcttatttttatagtgggtgatgacaacaataagtagaagggaagaaatgcattt
tattagtattttttataaaacttcaaaataaaattgctgaaatcttatacatgttcagta
EXON 6  220 bp
tcatattcatgttcaaacataattctaaagaaaatagctttaatctgtaaattggttaag
aacctatccctatcctctacttttagtaacttgagttaccttgccaaattaaagttcaaa
agttactttgtagatgaatacgaaaccaacagttttttccttctttttctttatttacag
CCTGGTCTGCCACCTCAGAACTTTTCAATGTCTGTCACAGTTCCAGTGACCAGCCCCAAT
GCTTTGTCCTACACTAACCCAGGGAGTTCACTGGTGTCCCCATCTTTGGCAGCCAGCTCA
ACGTTAACAGATTCAAGCATGCTCTCTCCACCTCAAACCACATTACATAGAAATGTGTCT
CCTGGAGCTCCTCAGAGACCACCAAGTACTGGCAATGCAG
gtatgtagtgatacctattatgctggttctttaataaagagggtgaaaaaattcattgct
aacataagcagtttcttattttgctattcttttattgctttgatgagcaagaatcactga
tacataattggcctcattttaaagtatttttttgaaaatcaattgtgggtgtagcattgt
EXON 7  60 bp
gatataataactacatcagattacatgttaatgccaacttcagactgagctagtttttat
ttttgtgtctttttaggattagagtgagagttatctctattcagttcacgttcagttagg
taaagagagctaattcatattcattctctgccctctgtcttctctccgtaacgttgttag
GTGGGATGTTGAGCACTACAGACCTCACAGTGCCAAATGGAGCTGGAAGCAGTCCAGTGG

gtgagtgaattcctactcttctgttttgtaggtatctatcctatatgagatcaaaggaat
gttgttcctgaaataaagctttctgggaaatttccttctgaagggtactttcactaatac
atcaagataatttcttaaggggagactttctctaacttccctgcttaccaaagttagact
EXON 8  188 bp
aagtattccaaaatcagaaacacttctggtcccaagcatttcggacaagggatactcaaa
cctgtagtgagttttgttataaaatttatttgcaactcagactggggaaaacttgatttg
tttgtgccaaagtattttaataactcttctcactttattgaatgatatttttccccccag
GGAATGGATTTGTAAACTCAAGAGCTTCTCCAAATTTGATTGGAGCTACTGGTGCAAATA
GCTTAGGCAAAGTCATGCCTACAAAGTCTCCCCCTCCACCAGGTGGTGGTAATCTTGGAA
TGAACAGTAGGAAACCAGATCTTCGAGTTGTCATCCCCCCTTCAAGCAAGGGCATGATGC
CTCCACTA
gtaagttgaacctttcttcaacttcattctttaaaacacatattttatacatagtcaatc
tgtagcttcctttggaattttctgtgccaccgtagaatctacacctattcctaataaata
tttccattcaaaattagtatttgaagagacaagtctatttcaaatacacaaaaatcagat
EXON 9  24 bp
tttgaaaactcaacaagtagagacaagtaatttatatttctatctgttgtgtatataatc
gtctctttagagttccagacagctgctagtgtccaaatatgttttttctaaagaaatatt
ttgtttgtgagtaccaacagtcttagtaactctcttatccctcttatgtgctgagtacag
TCGGAGGAAGAGGAATTGGAGTTG
gtgagtgtgggtttctgcttgaaggaagttgaaaaagatgtagaaagtactaattctctt
acgtgttgttatctaaccaatgttccctttgttacacaaatttttttaaacactattcaa
acactttgaataaagcaatctactggtactacagactctagtttttctatttataattgt
EXON 10  127 bp
ggacccttcaaattaaatatttagttattctcactagtatttttgaagttttcacatcat
cagtgcttcagaaaatgacattcatatgaaactgtgaaaaatgtcacttaaattgaaagt
gatttttaagtcaacataaataccacatcagaacacattttctcttttttgatctcacag
AATACCCAGAGGATCAGTAGTTCTCAAGCCACTCAACCTCTTGCTACCCCAGTCGTGTCT
GTGACAACCCCAAGCTTGCCTCCGCAAGGACTTGTGTACTCAGCAATGCCGACTGCCTAC
AACACTG
gtgagcctgctctggtgccttccgtaggttttaccgctctctgttttgtgatcaacgtgt
gcttctgtgattttttttaagtatatttattgaaataaactatttccagttttttagatt
taaattaggatgtatttttcaatgtgctagccttgaaaaaattacaaacaaaatggatag
EXON 11  127 bp
gctggtctcaaactcctgacctcaagtgatccgcccatcttggcctcccaaagtgctggg
attactggcatgagccagcatggctggcctcaatgtaggaacttttgcagtagctacgta
aaaaatagattccgtatggaccttccatcatatgcagagccctcttgtcttcctttgtag
ATTATTCACTGACCAGCGCTGACCTGTCAGCCCTTCAAGGCTTCAACTCGCCAGGAATGC
TGTCGCTGGGACAGGTGTCGGCCTGGCAGCAGCACCACCTAGGACAAGCAGCCCTCAGCT
CTCTTGT
gtgagtaactagaagttttccctgcatctttactcctggcctacacactctcttttccta
tcagtgacagccttttgctctgttgagtttcgtgtgaggaatcctgtaatgattcctttt
caggtagatacaagtgtcgggagaaaatattttcttacatggctctagacagtagcttgg
EXON 12  1397 bp
ggaagatgggatttccttttgtgccaagcactgaaggaaacgacccaaaccagtcttggg
gaactctgataagatttcagactctgggcccttttccatcaggcagtgtctctactgtat
catcccagttttgcagaggtacttgcaagccatctgacctctctcttttttttccttcag
TGCTGGAGGGCAGTTATCTCAGGGTTCCAATTTATCCATTAATACCAACCAAAACATCAG
CATCAAGTCCGAACCGATTTCACCTCCTCGGGATCGTATGACCCCATCGGGCTTCCAGCA
GCAGCAGCAGCAGCAGCAGCAGCAGCAGCCGCCGCCACCACCGCAGCCCCAGCCACAACC
CCCGCAGCCCCAGCCCCGACAGGAAATGGGGCGCTCCCCTGTGGACAGTCTGAGCAGCTC
TAGTAGCTCCTATGATGGCAGTGATCGGGAGGATCCACGGGGCGACTTCCATTCTCCAAT
TGTGCTTGGCCGACCCCCAAACACTGAGGACAGAGAAAGCCCTTCTGTAAAGCGAATGAG
GATGGACGCGTGGGTGACCTAAGGCTTCCAAGCTGATGTTTGTACTTTTGTGTTACTGCA
GTGACCTGCCCTACATATCTAAATCGGTAAATAAGGACATGAGTTAAATATATTTATATG
TACATACATATATATATCCCTTTACATATATATGTATGTGGGTGTGAGTGTGTATGTGTG
GGTGTGTGTTACATACACAGAATCAGGCACTTACCTGCAAACTCCTTGTAGGTCTGCAGA
TGTGTGTCCCATGGCAGACAAAGCACCCTGTAGGCACAGACAAGTCTGGCACTTCCTTGG
ACTACTTGTTTCGTAAAGATAACCAGTTTTTGCAGAGAAACGTGTACCCATATATAATTC
TCCCACACTAGCTTGCAGAAACCTAGAGGGCCCCCTACTTGTTTTATTTAACTGTGCAGT
GACTGTAGTTACTTAAGAGAAAATGCTTTGTAGAACAGAGCAGTAGAAAAGCAGGAACCA
AGAAAGCAATACTGTACATAAAATGTCATTTATATTTTCCAACCTGGCATGGGTGTCTGT
TGCAAAGGGGTGCATGGGAAAGGGCTGTTGATATTAAAAACAAACAAAACAAAAAAGCCC
CACACATAACTGTTTTGCACGTGCAAAAATGTATTGGGTCAAGAAGTGATCTTTAGCTAA
TAAAGAAAGAGAATAGAAAACACGCATGAGATATTCAGAAAATACTAGCCTAGAAATATA
GAGCATTAACAAAGTAAAATTAATATATTAAGTTATAATTGGAATATGTCAGAAGTTTCT
TTTTACATTCATATCTTAAAAATTAAAGAAACTGATTTTAGCTCATGTATATTTTATATG
AAAGAAAACACCCTTATGAATTGATGACTATATATAAAATTATATTCACTACTTTTGAAC
ACATTCTGCTATGAATTATTTATATAAGCCAAAGCTATATGTTGTAACTTTTTTTTAGAG
AATAGCTTTATCTTGGTTTAACTCTTTAGTTTTATTTTAAGAGGGGAAAACAAAAATATC
TTGCAAGCAGAACCTTG
gaaaaaaaaagccatgaacacttattctaaatgtaaattaaaagttgagccaaactcttt
gtgtatatagcatcttaaatatattatcacctttgatgtaagtacctatgtattgtatgg
tcaccagattaaaaagtatatttttgtggattgccgccaatctggggggaaaaggcgagg