Gene IDH3A Variant 1
DNA : 21.16 KbNT_010194
mRNA : 2664 bp NM_005530
CDS : 1101 bp NP_005521
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  54 bp
gccaggccagtcacagagagacgagcccggcgattcgccagcggaatgtccaggggcggg
gcagcgagcgagcgcgaagcaatcctgaggcggtctagggggcggggcgttcagggggcg
tggccgtgcaggggcgggctccgagcgtggggtgggcgcttgcgcactgccgctgcggct
GTTGCTGCGGAGCCAGGAGGGGAAGCGATGGCTGGGCCCGCGTGGATCTCTAAG
gtgagcgctggcaggccggcgtgtggcaggcaggcaggccgcgagggctggcaggagagc
cggtcgcgtgccgggtgtgggcgggcgcgtgggccagacagggaggcggtggctgcccgc
ggggacagcttgggagccggtcctggtcgcccgtgccccgcgctccgtggccggctcgca
EXON 2  63 bp
gctttcaaatctgagatagcttgccacattgagctaatacatgagatttgtattcctggg
aagctactgaatatatctgtgccaagttgcagcattaccatccatcaggacttcctcgct
cttgtttactgtatgtggtttaattctgtgtgtgatatttctctgttgatattaatatag
GTCTCTCGGCTGCTGGGGGCATTCCACAACCCAAAACAGGTGACCAGAGGTTTTACTGGT
GGT
gtgagtataattatgtcttttattttttccttttagaagtttctcaagaaagatgctcta
acatatttattatatagcattttatctccattcatttagaatttgggaaaattggccata
tttataatgtatgttgaaattactggctgacatgcacaaatctgttaggttacttgcgca
EXON 3  84 bp
ctcctctgttgattcctgcctcccctttgatgacccccggggaggtatgtttgttttctt
aacagcatttgaatcttcctgagacatctcataaagtggatttctctgtcaaaatattct
tttttaagccttcaaaaacaaaaattcttactgtcttctttgatgatttcttatgttcag
GTTCAGACAGTAACTTTAATTCCAGGAGATGGTATTGGCCCAGAAATTTCAGCTGCAGTT
ATGAAGATTTTTGATGCTGCCAAA
gtaagtgggcttaaaaaatacatttaatgatgactcactgaaaagttttcttagccagtt
ggattctgtgaacttttaggatgcattgtacccatttctatgaaatttagtcaggtctgt
tgttaatctccaccgattgtcactttaacagtgtgtgtctcagtgtttgctactgccatt
EXON 4  115 bp
tggaacctgggaggcggaggttatagtgagccaagattgtgccgctgcactctagcctag
gcgacagagcgggactctatctcaaaaacgaagttgaaaaagtttgttcatcattgcagt
atgaatgccagtttcctttaagtctctccagctcactgtgctctgtgatgtggcatctag
GCACCTATTCAGTGGGAGGAGCGGAACGTCACTGCCATTCAAGGACCTGGAGGAAAGTGG
ATGATCCCTTCAGAGGCTAAAGAGTCCATGGATAAGAACAAGATGGGCTTGAAAG
gtagcactgaagtagagacgggggtttttacagatttccgctacaggggttacttagttt
tgaaaatttatgcatttaaactgaataaggcctggccatctgtgaaggtaacgccattct
tttatgaagtaactactcatagtaagatgttttattcatttgggacatttttttccccca
EXON 5  188 bp
gaaacgcagttaatgttccagaaagctcccgtgaggaagtgttcctccttcatttgaatc
tcaggtagagagtgaactagaggcagaacacatttcacaaggtagccgaggtgggttagt
aggtcacacgtgagaccagaattccttctagtgtcatctgggttttcttctgtataacag
GCCCTTTGAAGACCCCAATAGCAGCCGGTCACCCATCTATGAATTTACTGCTGCGCAAAA
CATTTGACCTTTACGCGAATGTCCGACCATGTGTCTCTATCGAAGGCTATAAAACCCCTT
ACACCGATGTAAATATTGTGACCATTCGAGAGAACACAGAAGGAGAATACAGTGGAATTG
AGCATGTG
gtatgttcactccagattcttttttattcctgcttggactgctttctgtgcatctgggac
cccagagacagatctgctttatctctgtgaggagttgtgggtgtttgtcttggtgctggg
tgtctggctgacagtactcaaacaaatgtaaggcatggtggttcgcgtcacaagcttggg
EXON 6  134 bp
acttacctcttagggctggagttaacatgaaccccattgtcgtagcagtgtgtgtgatta
gtcatgctagctggcactgtgcaggcctgccacaaatgttactgtctactccccaccctc
tgtctcccactgcgttgctgtcacactctttccagcaaggtgggacttcctgtcttgcag
ATTGTTGATGGAGTCGTGCAGAGTATCAAGCTCATCACCGAGGGGGCGAGCAAGCGCATT
GCTGAGTTTGCCTTTGAGTATGCCCGGAACAACCACCGGAGCAACGTCACGGCGGTGCAC
AAAGCCAACATCAT
gtgagctccttgcgggggccggcaccccatcttgctttgttgtgggagagcagtgacagg
gcttccctttctcctcttcagcttgttccttgattcctaatatctttgaaaaagaacttt
gtaacaatccaaagatacggcatctctcttctgtcggagtctcctcttttctcctctgtt
EXON 7  103 bp
atcctaaaacattttcagcttatattttattaactacctaagaaataattttattgtaat
tgggatcaggtagcttggcttctggaacttaaatgtcttgaacttactttacttctttga
tttgattcttttctttctgtaagacttttttttcagcagtttttatttgattaaatacag
GCGGATGTCAGATGGGCTTTTTCTACAAAAATGCAGGGAAGTTGCAGAAAGCTGTAAAGA
TATTAAATTTAATGAGATGTACCTTGATACAGTATGTTTGAAT
gtaagtatatattcacacttacctgctactttttatggtgaatggtgtctgtgtgttgtg
gggatgcagattttgattactaaatgcacaaatgtattccttgtagatggtacaagatcc
ttcccaatttgatgttcttgttatgccaaatttgtatggagacatccttaggtgagtctg
EXON 8  65 bp
aatgcagggaagttgcagaaagctgtaaagatattaaatttaatgagatgtaccttgata
cagtatgtttgaatgtaagtatatattcacacttacctgctactttttatggtgaatggt
gtctgtgtgttgtggggatgcagattttgattactaaatgcacaaatgtattccttgtag
ATGGTACAAGATCCTTCCCAATTTGATGTTCTTGTTATGCCAAATTTGTATGGAGACATC
CTTAG
gtgagtctggctgcaacctatttattttagcctatgatttacttataaacatcctaaaat
aattatggcttaacattttcaattgagtattgtgaaatagagtatttgttgtaacatatg
aattgaattctaacagttcaggttgtgatatgaatgattacatgttgggtggcttgttcc
EXON 9  85 bp
gacacagtaagatgctcgaggctcatctgtattttcctaacctttgccctggaatcagcc
atttatccaaggaatgctacttccttttagtggagaatgataattaaaaactaaaatctg
ggtgctaggtgagatgttttatttttaaaaacattctttgaaatgcttttcttccgctag
TGACTTGTGTGCAGGATTGATCGGAGGTCTCGGTGTGACACCAAGTGGCAACATTGGAGC
CAATGGGGTTGCAATTTTTGAGTCG
gtaaggaccctgacacctgaaacagaactcaggtcagaacagcgtgtgaactcaggagga
gttatctgtataagtatgctttaactccagtttttcaaattgtcaaaacaaaatgatgct
ttttttttttctcgagacggagtctcgctctgtcacccacgctggagtacagtggtgcga
EXON 10  153 bp
tgagctatcacgcccaacccagactttatttcttcagtccatatcagatgaattgcacgc
agtagctttcagtgcatattttgtattgctgaggaaagatggttaagactccagcttccc
cagaagaggactgttagtttttgtctctcccttgatgatgctacttttcccgatgtgtag
GTTCATGGGACGGCTCCAGACATTGCAGGCAAGGACATGGCGAATCCCACAGCCCTCCTG
CTCAGTGCCGTGATGATGCTGCGCCACATGGGACTTTTTGACCATGCTGCAAGAATTGAG
GCTGCGTGTTTTGCTACAATTAAGGACGGAAAG
gtaacaggaatcttgatttacttgtgctgggtaaaatgcattgcttccatgtgttttatc
tgagtgaaagggacagtgacagataatagttctcaggcgggcccaagcatttgatgttga
acaaggattcttaacgtgggtcccagattgaacagggtatgtgtgcacatgtgtgcattt
EXON 11  1620 bp
cccgatcctcctgggctgggtagatggtggtggagtggttcctcactttgaaatgaggaa
ctaaatgaaagagcagccgagtaacttgcccaggtggcatctcactgagggctttaaaat
ctccttggtttagtttagtttgcggatacatcttttatttttgctttttccttttctcag
AGCTTGACAAAAGATTTGGGAGGCAATGCAAAATGCTCAGACTTCACAGAGGAAATCTGT
CGCCGAGTAAAAGATTTAGATTAACACTTCTACAACTGGCATTTACATCAGTCACTCTAA
ATGGACACCACATGAACCTCTGTTTAGAATACCTACGTATGTATGCATTGGTTTGCTTGT
TTCTTGACAGTACATTTTTAGATCTGGCCTTTTCTTAACAAAATCTGTGCAAAAGATGCA
GGTGGATGTCCCTAGGTCTGTTTTCAAAGAACTTTTTCCAAGTGCTTGTTTTATTTATTA
AGTGTCTACCTGGTAAATGTTTTTTTTGTAAACTCTGAGTGGACTGTATCATTTGCTATT
CTAAACCATTTTACACTTAAGTTAAAATAGTTTCTCTTCAGCTGTAAATAACAGGATACA
GAATTAACAAGAGAAAATGTCTAACTTTTTAAGAAAAACCTTATTTTCTTCGGTTTTTGA
AAAACATAATGGAAATAAAACAGGATATTGACATAATAGCACAAAATGACACTCTTCTAA
AACTAAATGGGCACAAGAGAATTTTCCTGGGAAAGTTCACATCAAAAAGAGTGAATGTGG
TATATTTCTAAATGATATGGAAAATAGAGACAGATTTGTCCTTTACAGAAATTACTGAGT
GTGAATAAAAACTTCAGATCCAAGAAATATATAATGAGAGATATAATTTTTGTTAATAAG
ACAAAGGTAATATATTGGATACAAAGACACAAATGTATTGTGTGTTCAATTATTTTGTTG
TCTTGAGATTTAATATTCTTTCCAAGAGCTTTTAATGAAGCAGAGAGCTAGTACTTCATT
TTCACTGGATACATTTTCAGCATCATGAGTTGTCACAGCCTCTGAGCCCCTGATCTGAAG
CCAGAAGGGCTGAGTGTATTGTAAACTTATTCTTGCATGTTGCTGTCTGGGAATGGACCA
CACTACAGCAGGTAGTTCTGGGGGCGATACTGCCGAAAGGCCCGAACACATGTATTTTGG
CTGCAATTGAGGAACTTGGGATGCTATTAATTTTGTATTTCAGCAACTGCCCCTTCTCCT
ATCCCAAAGCACCAATTACTGCCCTCTGCCTCAGCAGTACCAGTATAAGATGACATTCCA
AAGACTGGAGGCAACTCAGCCTGAGTTAATTCACAAAATTATGCCATGCTGGGGCTTGAG
CTTGAGCTTGGGCTTAGGCTTGGGCTCAGCTTTTGACCCTCAGGCATCTCCTTTCCCTTC
CTGTCTTCCTCTCCCTTCTCCTCTGCTGCAGCATGATTTTCTTAATCTTCAGACACTCAC
TATTTTCATGAACAGTTACCCTCTGTCCCCACAACCAAAGACAACTCATGGCCTCCTTTG
GCCCTTGTGTAACATTGCAAACCTGTGGCTTTGCAAAATGTACCCAGGTCACAAGGGGAT
TTTTTTTTTTTTAGCAATGATATCCCTGTCTGGGTCACTTTTTAAGCTTGTAACCGCCCC
CCCAGACTTATAATCTTAAATGTATTTTCCTTTGTTTAAGCTGCTGCTTCCTCTGTTTCA
TTGGATTGTGCCAGTTATCAGTGGCTCTTGGGTTCAAAGTAATAAAGAATTCCAAAACTG

agatgtttgctttctctacctgtttcctgttcagatgccttcggtcattttggctcagct
tgctactgagaatggctgcttcccgtattcagaatggaagtggggtggtctggtggcgac
aggctaacgtagagctggctgcttttatgagaatgcgccacttgaccccatcctgcacct