Gene HAPLN3 Variant 1
DNA : 18.25 KbNT_010274
mRNA : 1893 bp NM_178232
CDS : 1083 bp NP_839946
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  81 bp
tcttgcacaccctctttgcggtggttcccagcgagtctggagaccgctcaagcctgcagc
agctcctcccttcgagcccagcccttgggagggaaaggtgcgcgtgttcctttaaggggc
tggtctggcgggagcgcgggggtttttctgctgccgcttcctttctgcccttttaatttc
CCCGAAATCAGACTGCTGCCTTGGACCGGGACAGCTCGCGGCCCCCGAGAGCTCTAGCCG
TCGAGGAGCTGCCTGGGGACG
gtacgtggcttaggggtcgctgggcttctggggctgtgtgcgggccgggttcctccctta
ccgctttgggtgccctgcgggtccccacacctcccgggcagggtccggggaaggggcagg
aggcgtgggccgggcactgcggaggcccgggctgagatgggctgtgatcgcgggcgaggg
EXON 2  171 bp
aggaaccccatctagcttgtcactgctgtcttctcagctccgggaacagcgtctggcacg
taggcggcaggtgtcccgcagtgagctgttgagcaagcgagtgagtggtgttggagcaga
ggggatgtgggccctggaagccaggcttttctaattgccttgttttcctccccttcccag
TTTGCCCTGGGGCCCCAGCCTGGCCCGGGTCACCCTGGCATGAGGAGATGGGCCTGTTGC
TCCTGGTCCCGTTGCTCCTGCTGCCCGGCTCCTACGGACTGCCCTTCTACAACGGCTTCT
ACTACTCCAACAGCGCCAACGACCAGAACCTAGGCAACGGTCATGGCAAAG
gtaggcgacctcctgcacccggctctttgctcccctgggtgacctagacctccttggctc
ttgctgtgatctgagggttccaggctgggacagggacagcagccctgttccagcagggcc
cttgtagtgggccagcttgcttctcagacaggggaaggggtgagttcattttcctgtgtt
EXON 3  369 bp
cttgatggaaggagatgcaaagtcacattgcagagcatgtggatacagggaggggtggag
catggtggccatttttgcaatctgagcctgtaggagccgtggatgagggtgtgcggtggc
ccttgcaggggtacagatgtgcttcagcaggtctcatctgcaccctgtctctcccccaag
ACCTCCTTAATGGAGTGAAGCTGGTGGTGGAGACACCCGAGGAGACCCTGTTCACCTACC
AAGGGGCCAGTGTGATCCTGCCCTGCCGCTACCGCTACGAGCCGGCCCTGGTCTCCCCGC
GGCGTGTGCGTGTCAAATGGTGGAAGCTGTCGGAGAACGGGGCCCCAGAGAAGGACGTGC
TGGTGGCCATCGGGCTGAGGCACCGCTCCTTTGGGGACTACCAAGGCCGCGTGCACCTGC
GGCAGGACAAAGAGCATGACGTCTCGCTGGAGATCCAGGATCTGCGGCTGGAGGACTATG
GGCGTTACCGCTGTGAGGTCATTGACGGGCTGGAGGATGAAAGCGGTCTGGTGGAGCTGG
AGCTGCGGG
gtgagatgctaacggggactgggtgacactgggacctgagagcagaggggagaggaccag
agaaaacatccagacctctgtgctttagacatttaaaagtacttaattctcaaaacaacc
cacatggaagctactgttgtgacccccattttacaggtgagaaaactgaggcacagagag
EXON 4  303 bp
agtcccaggagagaggcggcaacggacaggaggtcagaggtttgctgagtttttctgagg
gatggtgtatgtgtgtgtgttgcaggcagcacatgtcccagtgaaggtgggaggagagcg
gggtgtccagccagctgggcccctggccaccccctaagctcctctttccttcccctgcag
GTGTGGTCTTTCCTTACCAGTCCCCCAACGGGCGCTACCAGTTCAACTTCCACGAGGGCC
AGCAGGTCTGTGCAGAGCAGGCTGCGGTGGTGGCCTCCTTTGAGCAGCTCTTCCGGGCCT
GGGAGGAGGGCCTGGACTGGTGCAACGCGGGCTGGCTGCAGGATGCCACGGTGCAGTACC
CCATCATGTTGCCCCGGCAGCCCTGCGGTGGCCCGGGCCTGGCACCTGGCGTGCGAAGCT
ACGGCCCCCGCCACCGCCGCCTGCACCGCTATGATGTATTCTGCTTCGCTACTGCCCTCA
AGG
gtgagtggaatagccaagcgcgggcctgtgggtttggtggccacctgggacctgtgagag
ggcagcttctggggagctctggccccctctgctggctctgctggtactgccacctggagg
ccaagagcaccagccaccctagaagcagcatctggttgagttttgagtgctttgctgctg
EXON 5  969 bp
ggcaggtgggacagagctctctgggacagggtgaagattagaaagtgttctctgcagatg
cctgcagtatggtagctccctgggctcagacgggtctttggggctggcatctctgcagac
cccgctgtgctctctggctgccccctgcgctgtacggcactcacgccccctttcccccag
GGCGGGTGTACTACCTGGAGCACCCTGAGAAGCTGACGCTGACAGAGGCAAGGGAGGCCT
GCCAGGAAGATGATGCCACGATCGCCAAGGTGGGACAGCTCTTTGCCGCCTGGAAGTTCC
ATGGCCTGGACCGCTGCGACGCTGGCTGGCTGGCAGATGGTAGCGTCCGCTACCCTGTGG
TTCACCCGCATCCTAACTGTGGGCCCCCAGAGCCTGGGGTCCGAAGCTTTGGCTTCCCCG
ACCCGCAGAGCCGCTTGTACGGTGTTTACTGCTACCGCCAGCACTAGGACCTGGGGCCCT
CCCCTGCCGCATTCCCTCACTGGCTGTGTATTTATTGAGTGGTTCGTTTTCCCTTGTGGG
TTGGAGCCATTTTAACTGTTTTTATACTTCTCAATTTAAATTTTCTTTAAACATTTTTTT
ACTATTTTTTGTAAAGCAAACAGAACCCAATGCCTCCCTTTGCTCCTGGATGCCCCACTC
CAGGAATCATGCTTGCTCCCCTGGGCCATTTGCGGTTTTGTGGGCTTCTGGAGGGTTCCC
CGCCATCCAGGCTGGTCTCCCTCCCTTAAGGAGGTTGGTGCCCAGAGTGGGCGGTGGCCT
GTCTAGAATGCCGCCGGGAGTCCGGGCATGGTGGGCACAGTTCTCCCTGCCCCTCAGCCT
GGGGGAAGAAGAGGGCCTCGGGGGCCTCCGGAGCTGGGCTTTGGGCCTCTCCTGCCCACC
TCTACTTCTCTGTGAAGCCGCTGACCCCAGTCTGCCCACTGAGGGGCTAGGGCTGGAAGC
CAGTTCTAGGCTTCCAGGCGAAAGCTGAGGGAAGGAAGAAACTCCCCTCCCCGTTCCCCT
TCCCCTCTCGGTTCCAAAGAATCTGTTTTGTTGTCATTTGTTTCTCCTGTTTCCCTGTGT
GGGGAGGGGCCCTCAGGTGTGTGTACTTTGGACAATAAATGGTGCTATGACTGCCTTCCG
CCATCCCCA
gcccttttctgtgtctccatctcgttcggtctcagggcgcagccccctgcctggtgggtg
tggtgggggcagttctagcccaggcttcataggttggctgggtcaggtccctggggtgaa
cagggaactctgcgggctggttctagccttgcctgctcaatggttcacccggtcctgggt