Gene GABRB3 Variant 2
DNA : 226.79 KbNT_026446
mRNA : 3041 bp NM_000814
CDS : 1422 bp NP_000805
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  222 bp
cgccgaggcgggaggggagcgcccagggccccggcctcgggccgaggcgagcgtggggga
gggcagggtgcgcggcgcggcggctccgcctccgactctccggcctcctcccccgccccg
cgcccgcgcgcgctcctccctccccgctcctccttcctctcccagcgcccgctcctcccc
CTCCTCCCCTCCCCCTCCGCCCTCCTCCGCTCCGGGCCAGCGCGGCGGCGGCGGCGGCGG
CGGCAGCAGCAGGAGCAGCCCCGGCTGCGGGTCGCGACGGCGGCGGGGCGCCCCCTCCCC
CGTGCCGGGGCGCGGCGGAGGGATGTGGGGCCTTGCGGGAGGAAGGCTTTTCGGCATCTT
CTCGGCCCCGGTGCTGGTGGCTGTGGTGTGCTGCGCCCAGAG
gtagggtcgcgggtgggccggcgggcggcgggcagggcgcggggtgcgcggggcgctggc
ggctgagccgcccctgaccccgctctttgtgctccccgtccctcccccagtgtgaacgat
cccgggaacatgtcctttgtgaaggagacggtggacaagctgttgaaaggctacgacatt
EXON 2  92 bp
ttgcgggaggaaggcttttcggcatcttctcggccccggtgctggtggctgtggtgtgct
gcgcccagaggtagggtcgcgggtgggccggcgggcggcgggcagggcgcggggtgcgcg
gggcgctggcggctgagccgcccctgaccccgctctttgtgctccccgtccctcccccag
TGTGAACGATCCCGGGAACATGTCCTTTGTGAAGGAGACGGTGGACAAGCTGTTGAAAGG
CTACGACATTCGCCTAAGACCCGACTTCGGGG
gtaagtgggctgcgcgcggccgttgcgggaagcgcgacccacggcggcggcggcctgggc
ggagggaggcgggggccgcatccgcggagcagcggcgggtgggagtgggggcccttcgcc
cgcgcccctcctgggatagcccccagtcctcagagccgcccgcgccccgcgccggagctg
EXON 3  68 bp
gcgcgacccacggcggcggcggcctgggcggagggaggcgggggccgcatccgcggagca
gcggcgggtgggagtgggggcccttcgcccgcgcccctcctgggatagcccccagtcctc
agagccgcccgcgccccgcgccggagctgggctgatcgccgtgtcctgtgcttcccgcag
GTCCCCCGGTCTGCGTGGGGATGAACATCGACATCGCCAGCATCGACATGGTTTCCGAAG
TCAACATG
gtgagtgcccgccctcccagggcggtccctgagcccccggcccgctgtctgggatcacag
gcgtccacagtgctgggccggaggcctcttcggccggggccgagtttccccggtccgcag
agggagccgcgctcccaggcgccggcccctcgcttgcccggctccctgcacccgccccgg
EXON 4  221 bp
aactggtatttgcattcacaagaaagcagccattgcttcccattctgcataaaaatggca
tccgtttctcctggttattcactgtagagcctagattgcaacctgaatttggctggtcgt
ggaggaaatacacctgtggctgggtacaaactaactttctttcttttcttttccccccag
GATTATACCTTAACCATGTATTTTCAACAATATTGGAGAGATAAAAGGCTCGCCTATTCT
GGGATCCCTCTCAACCTCACGCTTGACAATCGAGTGGCTGACCAGCTATGGGTGCCCGAC
ACATATTTCTTAAATGACAAAAAGTCATTTGTGCATGGAGTGACAGTGAAAAACCGCATG
ATCCGTCTTCACCCTGATGGGACAGTGCTGTATGGGCTCAG
gtctgtgtgcctcttcaggaccaattttgctgttgcatggtgcatgggtgttgaatatct
cacttgagatgattattgtaagtgaggcaatgacctcagataaattaggaagcatctatg
aagcactaaagctttgcagaaaaaaaaatctcataaccataaaatttggggcattactgt
EXON 5  83 bp
tattatgctgaaaagagtttcttatttactcaagtttctctctatatatagtgaatgatg
tttagccaggcgtactttgggcagggttcccacaggggcttactcgtttatctaagagga
gtctccctgatacatttctcagcccttctttaatatcttccctcaccctgtgtatttcag
AATCACCACGACAGCAGCATGCATGATGGACCTCAGGAGATACCCCCTGGACGAGCAGAA
CTGCACTCTGGAAATTGAAAGCT
gtgtgtatccgtatctgtgtttctttctcctcctatttgtacttttgatccttttgtcat
tatttagcatcttttttcaaggcatccataatttttttgacatagaaagaggggaagaca
cagagagagaaacacagagagagagagagactcagtataaaagagttcttcattctaatc
EXON 6  138 bp
gcagtaacatgagaatattggaaagttagttctttgatgacacttcccctagacaagcac
attaagcaaatctactcaaaacatagcagagccgcaacctccatgttaatgatagtttat
ttagccgtgcatttatacgaaatggtgatgtttgctgtctccctgcttctctcttggcag
ATGGCTACACCACGGATGACATTGAGTTTTACTGGCGAGGCGGGGACAAGGCTGTTACCG
GAGTGGAAAGGATTGAGCTCCCGCAGTTCTCCATCGTGGAGCACCGTCTGGTCTCGAGGA
ATGTTGTCTTCGCCACAG
gtgagtcctgcatccacttatagtcccttcaggggcactggctccatgggcgtgactgga
gtgacaaaatgtgctgccatagactcacagcacaggatcatcggaaggagtgctgttatc
attcacacatcacacacacccctcctctctgtatctaaaggagagtgataggctttgatg
EXON 7  153 bp
acccccctcctaattcttctataaataccgctagcagacagaagcaaactgcttggtggt
gggtcacccctttattcgcagacttttccattgcctgttgttgacctatggaagtcaaag
caaactctttagtctgccatgttgtttctccagtgtaatatccttgtctgtttcccatag
GTGCCTATCCTCGACTGTCACTGAGCTTTCGGTTGAAGAGGAACATTGGATACTTCATTC
TTCAGACTTATATGCCCTCTATACTGATAACGATTCTGTCGTGGGTGTCCTTCTGGATCA
ATTATGATGCATCTGCTGCTAGAGTTGCCCTCG
gtatgtgctatttttaagtgatatttaaatgtaaagtaaccgtatcattacagtattaag
agagttcaaaggctgtagttcaactaccattttttgacagcgtgacacaagcattgcctg
tatagtcactttttatcttgaaacactaatttcacgcacgattcccttgatgtgttaatt
EXON 8  245 bp
gagtggtgacgtgcggtgcaaatgacaagatgtatgctctgttgcattccagtcacccca
cagtattcaaccccttatctctgactacttaaagctgtttgagaaaacataaaaggaaag
tgaaaagtgaagaccaatgtggcaaagtttcagcctctcaccactttgtttcttttctag
GGATCACAACTGTGCTGACAATGACAACCATCAACACCCACCTTCGGGAGACCTTGCCCA
AAATCCCCTATGTCAAAGCCATTGACATGTACCTTATGGGCTGCTTCGTCTTTGTGTTCC
TGGCCCTTCTGGAGTATGCCTTTGTCAACTACATTTTCTTTGGAAGAGGCCCTCAAAGGC
AGAAGAAGCTTGCAGAAAAGACAGCCAAGGCAAAGAATGACCGTTCAAAGAGCGAAAGCA
ACCGG
gtaggctctccaccaccttgaccccacctggtccctgcagctcagcagctactgcattta
cttgcatgatatttctttgttttttccccagtagtgtatgtcaagccacacacccttctt
gtacttgtgatatagcccttatgacatggcacccaggtgttttttattcaggggttgctc
EXON 9  1819 bp
ctcaactgcaattaacctccaaaatgacattttccaataaaacggagtgctggatttgac
agatgtacagtttctcgtaaaacatgcaacatgtgatggcatgacatcattctgtccggg
atctgcatagggaaattatgctgctggctgtctaaccatgtgcattttccgtccaattag
GTGGATGCTCATGGAAATATTCTGTTGACATCGCTGGAAGTTCACAATGAAATGAATGAG
GTCTCAGGCGGCATTGGCGATACCAGGAATTCAGCAATATCCTTTGACAACTCAGGAATC
CAGTACAGGAAACAGAGCATGCCTCGAGAAGGGCATGGGCGATTCCTGGGGGACAGAAGC
CTCCCGCACAAGAAGACCCATCTACGGAGGAGGTCTTCACAGCTCAAAATTAAAATACCT
GATCTAACCGATGTGAATGCCATAGACAGATGGTCCAGGATCGTGTTTCCATTCACTTTT
TCTCTTTTCAACTTAGTTTACTGGCTGTACTATGTTAACTGAGTGACTGTACTTGATTTT
TCAAAGACTTCATTTAACACTGAGTGAAATATTACTCTGCCTGTCAAGTTTTTATACCTG
TACACACACAGACACACAAGCAGACACACACATATATACATACGCAATTGTATATATATG
TGAACTTTCTCAGCATATATATAAAATACACGTGTATATGAGGATGTATGTGTATATGTT
TATACACACAGGAGTCAGTGCCCATGTGTATGGAAGACAAATACACATACATATATACAT
TTTGCAGCTATGGACAATTTACCACAGGATGCATATTAAAGAAAGTCATAGTTTTTTTCT
TTTTTAATTGAAAGGGACAAGTATCATCTAAATATTATGCCTTGAGAATGAGGGCGTGAA
ACACAATATCATCCCCAAATGTGTCTTGTATTATCATAAGTTAGATGTTTTAGTTTAAAA
ATCAGAAAGACATTCTTAGTTAATCTTTGAAAACTCATACAGTGGTATTGCTAGTTTAAA
ATGAGTCACTTACTTCATATCCTCTCGTTCAGTTTAGTAAGCAAAGGCTTCTTGGCTTCT
CTGGTGATGGGGTTTGTTTTCATCGGGCATACGTTTTCTGCAATGGTTTAGTGGCTGGGG
TGAGCCACTGGCAGTGTGCTTACCTGTTGTCTGAAACATAGATAGATCCCACGTTGATGT
CTGAACGACCGTCTTTTGAAAACTCATCGGGAGTGAATGGCATCTCGTTGTAAGTACTCT
AATATACAGTGTGTAGTTTGTTTCTGTTGTTCACTTGGAGTGGATCCAGCTTCACTGTCA
TGTGCGAACACAGTGACACGTTTGGCCAGTGACATTTCAATCACTGAAAATGTGCTCTAC
ATCTCGTATGGATTTCTAGGCCTGATATCCAACAGAAAGCATAGACGTCTCAGGTTATTC
GTTACTCTAAGGTAAAACCATCTAGGATGATTTTCCCCCTTGCAGTTATGTTATCATTCT
TATAACATTGTATGTTAATAGAAAATATATTTGCATAATATGCATATATATGTATATTTA
CCAAGATTTTGTTTCTTACGCTTGCTATCATGGCAGCATGCGATGTCATATTTTCCTTTA
TGTGATGTAACTACTTTCTGTTATCTAGAAATTAAGATTGAAGCTAAAACACTTCTACTG
TTCAATTTCAGAAACTAAGAATCATCCTCATGCCTTTATTTCTGTATCTGACATATTTCA
TAAGCACATCCAACTACTCCTAGACTGACTAGGATTCTGCAGGAACATGACCCGTACACA
CCACGCGTCACCCAACGACCCATGACCGTTCTCTGAGGCAAAGGAGGGCAACCTGACAGC
AAACACAGTCACTGTTGGTTCCTTCTGATCCACAGCCTCATCAGTATTTGGACTTTTTAA
AGCTCGTAGAAACAAGACAAGGTGCACCGGTTTCATAGACGCAACCTTAACTTACTATTT
AGATGAGATCTTTCTAAAG
aaaaaaaaaagagatgatatattttttgtaaacaatatttctatcacaggcatccataaa
ctgaaatgactacagttgtgcaaacaggtgtcacagtgaagttgagcatttggagaaaaa
aataaaaagcaaaatttgcaggaagaactgctaaattaatactttatcccaaaatgccac