Gene DPP8 Variant 1
DNA : 71.05 KbNT_010194
mRNA : 2809 bp NM_017743
CDS : 2349 bp NP_060213
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  202 bp
cgctgttcctttctggagttcatctctatcccctgctcggcccagtctccaccccgcgcc
tccttggctcctccggccactagactgcgctgtggtgttggaccccacccagcagacagc
ggcgcccttcttggcccggctgcgccttcgccagtcggaaagcggatcgcaacgaaccgg
AAGTGCTAAAGCCTCCGAGGCCAAGGCCGCTGCTACTGCCGCCGCTGCTTCTTAGTGCCG
CGTTCGCCGCCTGGGTTGTCACCGGCGCCGCCGCCGAGGAAGCCACTGCAACCAGGACCG
GAGTGGAGGCGGCGCAGCATGAAGCGGCGCAGGCCCGCTCCATAGCGCACGTCGGGACGG
TCCGGGCGGGGCCGGGGGGAAG
gtgcagtatccgcccccttctccttctcctgcgccggcgaggcctgggccacggctcacc
aggccctttccgcctcacggagggactgctcggcgcgttctcagggtcagcgcgctttgc
ggtttacccggcgcgccgccctgcccagtgcagagccggtggtgcccttcccccctcccc
EXON 2  270 bp
aaactgaacacagagaagggagagctgttgcttttcttactaagtttcattgcagctgtg
ctaaaaagcatttttttcttgccctccccactcccccgctttttttttgaccctctcaga
gaatcattctgataatagaagatagacccgtgaacagcttcatgtgccttgtttttctag
GAAAATGCAACATGGCAGCAGCAATGGAAACAGAACAGCTGGGTGTTGAGATATTTGAAA
CTGCGGACTGTGAGGAGAATATTGAATCACAGGATCGGCCTAAATTGGAGCCTTTTTATG
TTGAGCGGTATTCCTGGAGTCAGCTTAAAAAGCTGCTTGCCGATACCAGAAAATATCATG
GCTACATGATGGCTAAGGCACCACATGATTTCATGTTTGTGAAGAGGAATGATCCAGATG
GACCTCATTCAGACAGAATCTATTACCTTG
gtgagtacgaagttgtagtttctgagagaaaatgatctcttaagtcaaacttaaagtcta
ggtataattgacactcaaaagtttgatgaataaattaatcagtgacttttggtttcatta
aagaaaagcctataatttgaagaattcgattttgttgtatcgcattaactttatttttac
EXON 3  113 bp
ggttttattgaaaatttttatggcatatggcataagcacattctacttgttaacattcat
tatatatcccatagagtgcaaaatattgcagtgtatagaaggcattatgtacttgcaact
gtgactgtagtaagaatgctattcgaaaaaataataataaatgattgctttctcctatag
CCATGTCTGGTGAGAACAGAGAAAATACACTGTTTTATTCTGAAATTCCCAAAACTATCA
ATAGAGCAGCAGTCTTAATGCTCTCTTGGAAGCCTCTTTTGGATCTTTTTCAG
gtaggattaaatgttgttattcctatgatttggtgtatgtattcagatactgcatttatt
tagaggttgggattttatatttgaagtagatgtaaataaaaaaaattaagatgtttttat
gtttttgcatgtatgaccctgaaattccatttaattcttgatatctgaaactgagataat
EXON 4  174 bp
cttgcagtgagccaagatcgctccactgcactccagcctgggtgacagagtgaaactctg
tctcaaaaaaaaaaaaaaaaaaaaaagagtcaataatgttggagattctaggatttcagt
gctaaaagcaaaagatggtttttcagaagactggaataggtgactttcctttcacattag
GCAACACTGGACTATGGAATGTATTCTCGAGAAGAAGAACTATTAAGAGAAAGAAAACGC
ATTGGAACAGTCGGAATTGCTTCTTACGATTATCACCAAGGAAGTGGAACATTTCTGTTT
CAAGCCGGTAGTGGAATTTATCACGTAAAAGATGGAGGGCCACAAGGATTTACG
gtaagttggagttgctagtgattaaatctggtttgggtccaaaaggttatttgtacccaa
agcagaaaggtaattaataaacaaaccagcaacttcagtttacccaccaacaaagaaatt
taatagcaatgaaaacaagaaacatggagattggtttccaattttaagagcgattttttt
EXON 5  169 bp
tgacttcaggtgatctgcctgccttggcctcccgaagtgctgggattacaggcgtaagtc
accacgcccggcctcattgttgacattttacctagaaatattgttcatcttataggaagg
gtgctggaacatgtatgtgtcagcctaatacttaccttaaaatgttgtttacttttctag
CAACAACCTTTAAGGCCCAATCTAGTGGAAACTAGTTGTCCCAACATACGGATGGATCCA
AAATTATGCCCTGCTGATCCAGACTGGATTGCTTTTATACATAGCAACGATATTTGGATA
TCTAACATCGTAACCAGAGAAGAAAGGAGACTCACTTATGTGCACAATG
gtaaggcgtagttcttcagatttacttttctgaacagtattttttgaagtataatttgct
gcttgcattttgaaattagattaccacgttgggtgatctttatatttgaaattcaagtct
ttaaaatttttaaaaaatggagaaaagtacagaggataacttgtatgtaccacatgtata
EXON 6  111 bp
atgagattggatgatttgcccaaagtcagacattatggaccccagatttgaactcagtcc
gttcagctccagagtttaccactgtattccagccacctttccaaataaactgaatcattt
tgctttgtacctatgaaaagatagctttctgtgataattttgccttttatatttgtctag
AGCTAGCCAACATGGAAGAAGATGCCAGATCAGCTGGAGTCGCTACCTTTGTTCTCCAAG
AAGAATTTGATAGATATTCTGGCTATTGGTGGTGTCCAAAAGCTGAAACAA
gtaagggggttcaaaataatatattatgggtcaattaaagtattgttaagattcaactgt
catttaagtgcacagttctaaatcttggataatagatttgaaagcggataatagattcca
aagtgatgatgattgattcatgcccatagttatttaaaatatgtagattaggctgggcac
EXON 7  129 bp
cttaacaataactcaccttgctactgcaaagactagtgatattttcctacaaaaaaggca
gcatattttatacataagttattcttcactataagaaatctgatactagaaggaacggtt
ggttatgactactctctggaataattcttctaaattttcaatatttaaatttcttttaag
CTCCCAGTGGTGGTAAAATTCTTAGAATTCTATATGAAGAAAATGATGAATCTGAGGTGG
AAATTATTCATGTTACATCCCCTATGTTGGAAACAAGGAGGGCAGATTCATTCCGTTATC
CTAAAACAG
gtactgtactccattggcatttatattcactcatttcctctttccaaataagattctttc
tgtagtcatccaaaggtgtagccaacaacattggtcatttccagccttatttacgacggg
ttgttcactaagtaccacaaaaatagattttgaattaaagggtgatctttttgattcttt
EXON 8  62 bp
aactcctgacctcaggtgatccacctgcctcaacctgccaaagtgctgggattacaggcg
tgagccactgcacccgacctatacgttattcttaactaaagtgtaaagaggattgatctg
gcaaaattaatttgagtaattttggataaacattactatcatttatgtctctttctaaag
GTACAGCAAATCCTAAAGTCACTTTTAAGATGTCAGAAATAATGATTGATGCTGAAGGAA
GG
gtaagtataaaatgctgagttgaccttctgcgtcatttgactaatctattcagcccagta
gggttctttgatacacttttttatttttggacttgctgaacttgctgagatatcggtgga
tcatgattttagattgacctaattttttacttgcaaatcatcctgctggttcataagatg
EXON 9  101 bp
taagtaccagtataggtaacccagaatttacttctagatttgctatatcctttgttcctt
tttaatacctaactctggaaaaattttctgctttttggataaattgttaaagtagactag
caagctaattatttatctaaatcttctataactagattctttttttttcttttttaatag
ATCATAGATGTCATAGATAAGGAACTAATTCAACCTTTTGAGATTCTATTTGAAGGAGTT
GAATATATTGCCAGAGCTGGATGGACTCCTGAGGGAAAATA
gtgcgtatgttaaattgttacttctttataactaatttaggatccagagctttggaatat
ttgtgctattaggtttgccttgtagttggagctgccttcacatgtaaatttgcagtacag
ttattactacacaaggcatttttcttgaattaagtggatttgtgcatttgtaatcctata
EXON 10  178 bp
tgttcaagcttaaagtgtatttttaattaactatttgtaagtgataatttaatatacact
aaagcagttctttcatggtgattacagatataattgataggtgccaaaggagataatagg
gaaatctttttctgatagcttgctttatttctggttcttctcttttatttatttaaatag
TGCTTGGTCCATCCTACTAGATCGCTCCCAGACTCGCCTACAGATAGTGTTGATCTCACC
TGAATTATTTATCCCAGTAGAAGATGATGTTATGGAAAGGCAGAGACTCATTGAGTCAGT
GCCTGATTCTGTGACGCCACTAATTATCTATGAAGAAACAACAGACATCTGGATAAAT
gtatgcattttttcctgtatttgtttaaatattttctcagaatgctaaagcaaatgaagt
tatatagcaaactatcaaaatgcatttttttttaagtttaaagggaccatgttatttctt
tagtatgagcatttccaattggagtgatggttccagaatggaatggtttgtattgataga
EXON 11  160 bp
taaagtaaaataaatctgaaagccccaagcaaaatttattactgtaaatatagcattcct
ttggcattgatggttatttatatttcaaagtatatttatcaagaaatttttcctgtagcc
taattgaattatgtagtattttcataatatgtatagtaaatttagctattcattttacag
ATCCATGACATCTTTCATGTTTTTCCCCAAAGTCACGAAGAGGAAATTGAGTTTATTTTT
GCCTCTGAATGCAAAACAGGTTTCCGTCATTTATACAAAATTACATCTATTTTAAAGGAA
AGCAAATATAAACGATCCAGTGGTGGGCTGCCTGCTCCAA
gtaagaaatccattttattttaaaaaaagaaaaaatgttggaagcagaaggtgggaggga
caggggaatgtatcttttgcatgctttataagcatcaatacttgctttgttaaacttaat
atgtaagttaaactaaaacataaatacatgtatgtgtaaaaaacacaggacaatgttctt
EXON 12  80 bp
tgcagtggcatttagtacattcacaatgctgtgcaaccatcatctctgtctagttccaaa
acatttttattaccccaaacataactttttggaaaaaagagcttagagtactgttcttaa
ttgtttcatttgcttatagtctggtataatgtactgaattataattatatttatcttcag
GTGATTTCAAGTGTCCTATCAAAGAGGAGATAGCAATTACCAGTGGTGAATGGGAAGTTC
TTGGCCGGCATGGATCTAAT
gtatgttattttattctactgatatgtttggtcagtattactgtgtgaatgcagtgctaa
aaatgagtaatgtaatttaatatgaccccggtatttttttttccgagacagagtcttgct
ctgtcgcctagggctggagtgcaatggggtgatctcggctcactacaacttccacctccc
EXON 13  153 bp
aactctttaaaaaataaataaataagcaaaattaactcaggtttattaatagtggcagca
aaaaaaagaaaaaagaaggcataagtcaaggagtggctcaagtgattgtaaataaaattg
ggggttagctttgccaaggtcatgttagccctgattttgttattgttgttatcttgtcag
ATCCAAGTTGATGAAGTCAGAAGGCTGGTATATTTTGAAGGCACCAAAGACTCCCCTTTA
GAGCATCACCTGTACGTAGTCAGTTACGTAAATCCTGGAGAGGTGACAAGGCTGACTGAC
CGTGGCTACTCACATTCTTGCTGCATCAGTCAG
gtattaagtttgtttaaaaagggttttgtgtcatattaaaactctctgcttatgtaatac
tccttttgaatgatgtgaaattggcctgcaaaagcctaattctctaaggaaaagctttaa
aaagcttaatttcaacattgtatatgtacataaatagtctcttataatactcttgctata
EXON 14  136 bp
aaattggcctgcaaaagcctaattctctaaggaaaagctttaaaaagcttaatttcaaca
ttgtatatgtacataaatagtctcttataatactcttgctatatcattagtgcagatgta
acagcagataaccttttctaccttcctgacgaaaaatataattgtttctcctttctctag
CACTGTGACTTCTTTATAAGTAAGTATAGTAACCAGAAGAATCCACACTGTGTGTCCCTT
TACAAGCTATCAAGTCCTGAAGATGACCCAACTTGCAAAACAAAGGAATTTTGGGCCACC
ATTTTGGATTCAGCAG
gtattcttttttccccctgatcctgacgttaagtaggattaatatattagtacactaaac
gtgtgtcatattttcacatttcctggacaagtctttccatctctcaccactgcctgtccc
tgagctgctgagctcctgatagatccctcttctcctattctgttagctactgaataagat
EXON 15  146 bp
cggcctagttttgtttttaaagatgaatatactcttgcttaaattctagcttatcatctg
aaagaggggtggtcagtttgtgttggcggggctgacttttaatatcttgtttcttgttcc
cagattgtagcactcccataagaactcttttgtagactctgttatgttacctattcacag
GTCCTCTTCCTGACTATACTCCTCCAGAAATTTTCTCTTTTGAAAGTACTACTGGATTTA
CATTGTATGGGATGCTCTACAAGCCTCATGATCTACAGCCTGGAAAGAAATATCCTACTG
TGCTGTTCATATATGGTGGTCCTCAG
gtgggcatatttatatacatatatacatacacccatatgcatatgtattttagatctttt
gttttttaaatgtctagtcagtttaagattttgagcattgttgggcatttgcttttaatg
actccgtcttatattccaattattcagtttagggggtcaggaaactggtttttgttggag
EXON 16  143 bp
atcaaattcttgaccttagcgcttcacttcgtattctgagttgcctaagacatgtatgcg
ccagtagtaaggctaaagcttaaggataattttagactgtaaatttgcagttgtaagatc
tcactgctagccactctctttttccagaccacacttgactgtcaatgtcatcttatgcag
GTTGCTATTGCTGGGGCCCCAGTCACTCTGTGGATCTTCTATGATACAGGATACACGGAA
CGTTATATGGGTCACCCTGACCAGAATGAACAGGGCTATTACTTAGGATCTGTGGCCATG
CAAGCAGAAAAGTTCCCCTCTGA
gtaagtgcaagcttttttttttttttttttaaattgagacagggtctcactctgtcactt
aggctggagtgtagtggcatgatcagggctccctgcagcgtcaaactcctgggctcagag
gatcctcccacctcagcccccgagtagctgggtttacaggcacgtgccaccatgcccgcc
EXON 17  112 bp
ccttcattgcatgtggcatctggttaatatgttacaaatttaatattgaaaatactgaat
tcttattctaacattacagtataaggaagttaatatggttaagtatgattaaataagtga
aatggttttcccaaatactctactattttgcctaatcctctaatatttccatttctccag
ACCAAATCGTTTACTGCTCTTACATGGTTTCCTGGATGAGAATGTCCATTTTGCACATAC
CAGTATATTACTGAGTTTTTTAGTGAGGGCTGGAAAGCCATATGATTTACAG
gtgagttactctacattttctagttaaatgcagtcatgattagtgattgattactttgaa
atctattagctgtggggtaagtccagatttttagagtgtccaccctctgcttaagagaac
taaagtaagaggcatatttagtagtgcctgtagttggataaaaattaagattctgttgca
EXON 18  370 bp
ttaaataaggaaatcataagatgaagagaggagcgtttagataggatttattctacaata
ttgcatagaggctgtgcttcgtattattaatcctgttaaaaatctctggaaagctttgga
agaagatgtattactaaattcttttttttttttgtatctttattttttgttgttggtaag
ATCTATCCTCAGGAGAGACACAGCATAAGAGTTCCTGAATCGGGAGAACATTATGAACTG
CATCTTTTGCACTACCTTCAAGAAAACCTTGGATCACGTATTGCTGCTCTAAAAGTGATA
TAATTTTGACCTGTGTAGAACTCTCTGGTATACACTGGCTATTTAACCAAATGAGGAGGT
TTAATCAACAGAAAACACAGAATTGATCATCACATTTTGATACCTGCCATGTAACATCTA
CTCCTGAAAATAAATGTGGTGCCATGCAGGGGTCTACGGTTTGTGGTAGTAATCTAATAC
CTTAACCCCACATGCTCAAAATCAAATGATACATATTCCTGAGAGACCCAGCAATACCAT
AAGAATTACT
aaaaaaaaaaaaaaaaaaaagacattagcaccatgtattcatactaccctattttcactt
ttaatagtattataaacttcatgaacttaattagtgtatttttacagtatacttttgagt
ttgttaaaatatgatgatattagtgattggtttggttcagttccagaatctttgactagt