Gene AVEN Variant 1
DNA : 172.88 KbNT_010194
mRNA : 1531 bp NM_020371
CDS : 1089 bp NP_065104
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  323 bp
cccagcggtccggccttcccgcggtcccggttccggccccacctgcgggacgccggccgc
cccgccccgccccgctccgctgcggccggcctcgatccctagccccgcaccccgcgcctc
gctgctaccgggcgcctttcgctcgcggctcctccgtgcggcccgcttccggtggggcca
GGGCGTCTCCGCCGCAGCTCGGCTCCCGCGCGCTCAGCACCGCCAGCGGCGGCCAGATGC
AGGCGGAGCGAGGAGCTCGGGGAGGCCGTGGGCGGCGGCCAGGCCGCGGCCGGCCTGGCG
GAGATCGCCACAGCGAGCGGCCCGGAGCCGCAGCGGCGGTAGCCAGAGGCGGCGGCGGAG
GCGGCGGCGGGGACGGAGGCGGACGCCGGGGCCGTGGCCGTGGCCGGGGCTTCCGCGGCG
CTCGCGGAGGCCGAGGAGGAGGAGGCGCCCCGCGAGGCAGCCGCCGGGAGCCGGGAGGCT
GGGGCGCAGGGGCCAGCGCGCCG
gtaagaggcgacggctggtggggctgggaccgcgtgtaactggggcaagtggggccgagg
ccgccagtcaagagccgcaagagagcgtgccaggcgcgcgccagacgggcggcggcgccg
gcgcctgcgcgggacgggcggatggtggcgcgggggcgcgcctggtggcgggggcgcgcc
EXON 2  178 bp
ttcaccctaaaagaacactctggtatagtgtgattctcttaaaataatatttaatatctt
cagacagcttggtctattgctttttattgttatgtccatgtacttttttgttttactggg
aagtctactaaggtcaggatttccactgcttacttattgatttgtctctaatgattgcag
GTTGAAGATGACAGCGATGCAGAGACCTATGGAGAAGAGAATGATGAACAGGGAAATTAT
TCTAAAAGAAAGATTGTCTCTAACTGGGATCGATATCAAGATATTGAAAAAGAGGTCAAT
AATGAAAGTGGAGAGTCACAGAGGGGAACAGATTTCAGTGTCCTCCTTAGCTCTGCAG
gtatgaattccagttgcatgcatactgtttagtgctctgaaagttgcacagacattttat
atatgtttttaaattctacttttataactagcaatttatcctttgttctttggattttta
attcaagtaaaggacagtgtttctaatggcttgtaagggaaaaaaatgagtttaagtgga
EXON 3  71 bp
gtcatctgtgtgttttgtaattttggaaatggagttggaggtatgttccagttttatcct
tgcctctccctttgagtttgagcacttcagaaatggcacttttgctctagcagggaaatt
tagagaactgagagtttccgttggcttttgcataaatttttttttttttcctattcctag
GGGACTCATTCTCACAGTTCCGGTTTGCTGAGGAGAAAGAATGGGATAGTGAAGCTTCTT
GTCCAAAACAG
gtaagataagagttgtgttaagtgtggactggctcttcttcaaggctgaaggctaacacc
ttttacgttcttgagatagagtcttcatgtagaaaagagtagtaattcttacagtgtacc
ctcagctaaacttttcagaaaattttcagggggctgaaattccacaggtccttgaagcta
EXON 4  96 bp
gctttggttttactgatcataatgtggagatgcagaaactctaacacataagtgtgatgt
atggtgtgacttattcctagccaaatgtaactccagtggattatttacagtttcttcttt
tatttccaaaaggtcataatcatcacctgatattttattttcttttatatatatatatag
AATTCAGCATTTTATGTGGATAGTGAGTTATTGGTTCGAGCCCTTCAAGAGCTGCCTCTC
TGCCTCCGACTCAACGTTGCTGCCGAACTGGTCCAG
gtaaaaatcccgaagccctcttgaagcgggtggattagggcaggaggagaaaaagagggg
aacacttccctcagcaggatgtctcagtgtcagcttccctttataaaagtgagggtttca
tatcaaggtagcattttgtaaagtttaaaggagaatccaaaaattttttgaagttacttt
EXON 5  361 bp
accccagatgtcaggaagggtgcccccaccagggcctggaaaggagccactttgtgaact
atctgaattgagtttcctctgtcacaaagtttgatggcttcgtttagcctcctatgtatt
tacttaagccaatatggcaagactcacatttttaactcagtttttatacttctctttcag
GGTACAGTTCCTTTAGAGGTTCCTCAGGTGAAACCAAAGAGAACTGATGATGGCAAGGGA
TTAGGGATGCAGTTAAAGGGGCCCTTGGGGCCTGGAGGAAGGGGGCCCATCTTTGAGCTG
AAATCTGTGGCTGCTGGCTGCCCTGTGTTGCTGGGCAAAGACAACCCAAGCCCGGGTCCT
TCAAGGGATTCTCAGAAACCCACTTCCCCACTGCAGTCAGCAGGAGACCATTTGGAAGAA
GAACTAGATCTGTTGCTTAATTTAGATGCACCTATAAAAGAGGGAGATAACATCTTACCA
GATCAGACGTCTCAGGACCTGAAATCCAAGGAAGATGGGGAGGTGGTCCAAGAGGAAGAA
G
gtatggctttcattttattccccgtgaatcttgattctggtgttttttcaagaacagccc
cgcccgcatcacatccgcacacatccctctgggtgtctgacattgatccagtgttgtcca
ctgacatctatttctgtgctcacgtctctgcttccccctgagctgacctttctgacaacc
EXON 6  502 bp
cagaataaagagcaaatcctctacccagctttatttgtttagatattactgtatcatctt
agggagtaagaataatgagaatgtttccccttgttgtaaggaaagtaataaattgggctg
aattataccttcaattttaggactcatctgagggtgttaacattgttttttttcccccag
TTTGTGCAAAACCATCTGTGACTGAAGAAAAAAACATGGAACCTGAGCAACCAAGTACCT
CCAAAAATGTTACCGAGGAAGAGCTGGAAGACTGGTTGGACAGCATGATTTCCTAAAAAG
GGGAAAAAAAGTGCCTGAAGCAAATCTTGGTTGCCTTCTAACGGCAGGTGGGCATAAGGC
TGTCCTTCAGGACCAGCCAGTTTACAAGCATGTCTCAAGCTAGTGTGTTCCATTATGCTC
ACAGCAGTAAATGCCTACCTCTGTGTTTGACATCTGAAAGAATACATTGAAGCAGCTTGT
TGCATTTGTTTTTCTGGCTTAGTAATCTAATAGATTTCCTTAAGGGCAGGAGATAGACTC
TGGCCCTTGTTTCTAGCCTCCTTCCTTGCAGTGTTTACAACATAGCCAGTGTTTACAGCA
TAGCAGATGCTGCTGCTGATTAAGAGAATAGATGCAAACAAGGCATGCATTTGGCCAAAA
TAAACAAATGCTGGTCTGTCCA
gttttcctttcctttcttgtgtggggccctgggcaattcgtctcatgtcccctttcccag
cagtcacagagtggttgtagaatcaaccagaagtggtacattccaagagtccagaccctg
gaggtattggtacgtattactttattgcagtgggcacttcattgtatttgaggagattca