Gene ANXA2 Variant 1
DNA : 50.64 KbNT_010194
mRNA : 1362 bp NM_004039
CDS : 1020 bp NP_004030
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  38 bp
ctcgggagcgttccagggcgcggtccctgcgggccggcgggccggggtgagtcacccctg
acttggggtgggagcgggccgtgtaagggggaggcggggcggggcggggcgggcctcgcc
tcgcctagggaggatgtggcgggtataaaagccccacccaggccagccggctctgctcag
CATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAG
gtaagcggggcgcgccctgcccgcccgcgatgggccgccagctagcggggtgtggagacg
ctgggaagaagggtacggcctggcagggaggccccggcaactggccccggaggccgtcgg
gggcagggggctgaagggacggccggcactggagagtctttggggagggggctcagggac
EXON 2  59 bp
gaccatctctgaggtttagtttttacagtcgtaagatgggaattgcatctgtttgcaaaa
actactccaatatcgtcagatgaaatggtccaaggagtagaaattagcataatgaatcgc
tgtgcttcagagtaaaggagagcctcttcataaagactttttgttgtactttttttccag
CTTCCTTCAAAATGTCTACTGTTCACGAAATCCTGTGCAAGCTCAGCTTGGAGGGTGAT
gtaagtatatcactttcactttatataatttttgcaagttggacatctctctggataacc
atattactctctatccttgtacatctaaggaagatggggacaattcagacagtcatcatt
tggttctcctctttcttaatacttcagctgttcctagtagttcaatttgaaggaaatatc
EXON 3  100 bp
ttagaaaaaatgaaattgcttgcgtgaagtgtgatggtgtgttaatacctacctagttac
ctagtatgagaatgatctgaattgttaaaagaaacaataggaaaacatattaggcattgt
tatttcaacaagaggattttaaatgtgtgtcatttgagtatgtttatcttttaacctcag
CACTCTACACCCCCAAGTGCATATGGGTCTGTCAAAGCCTATACTAACTTTGATGCTGAG
CGGGATGCTTTGAACATTGAAACAGCCATCAAGACCAAAG
gtaggtgatacatttgtcctcttcttgtcagggtcttactgagacatttttggttgtctc
tttattctccctcaaatcgccatacgttggcgatttgaaattgtcatcgagctttaatgg
agtagatccagacctagctcaacccatgcctcctttccttccttccctccttcctttctt
EXON 4  95 bp
agtgtacacattgggtagaggatgctgacgaaagagatagaacaaatcttggtgtctggg
tatttcagtttggaaaacagtatataaatttcagtttgaaaaagtctgcttgacaccttc
tatgtaagcccaaaatactagagtatactgagtaacgattaacaacttgtatttccatag
GTGTGGATGAGGTCACCATTGTCAACATTTTGACCAACCGCAGCAATGCACAGAGACAGG
ATATTGCCTTCGCCTACCAGAGAAGGACCAAAAAG
gtacaggcaattccagggatggagggcatttcttgttgaatttttgtttcctcagacatt
gctttttcttttcatgaattgtggctctcatgcgcaaaagacttgtgggacccttggata
tctaagattttcttcttaaatccttgtaagagtcactgcacatgtgtgtgtgcgtgtgtg
EXON 5  114 bp
tttatgtttctgagatgtgggtctgttgaagggaatgcagttgagggcgtttgacccaag
actccggagtggtcaaagactcacaacctgcttcacaaaaagatccctcttacttttgtt
ttactcactagttttaaagtaaaataaatattttccttatgattgcctgttatcttgaag
GAACTTGCATCAGCACTGAAGTCAGCCTTATCTGGCCACCTGGAGACGGTGATTTTGGGC
CTATTGAAGACACCTGCTCAGTATGACGCTTCTGAGCTAAAAGCTTCCATGAAG
gtaaatgcatgtgagatgtcatctctgtcaaatctgctattaattttgtgaattacagct
ttctgagtgtaatttggtgattttcagttttgttgaattctcatttggaaccatttttta
aaaatgaactgaagttatatgtctcaggatttgtaccaaaaatatttcaattacttgttt
EXON 6  91 bp
aatagaaaatgccattactttgtgctaaggggtaggagtatagattcttcagaaggaatg
tagaaagcaggatgctaacagacccaatccatgtttgcaatttacttgatggagatcaga
gaagtaggctaatggtggggaagcatttccctgctgatgttcgtgcttcctggttcacag
GGGCTGGGAACCGACGAGGACTCTCTCATTGAGATCATCTGCTCCAGAACCAACCAGGAG
CTGCAGGAAATTAACAGAGTCTACAAGGAAA
gtgagtagcttgatttctgtgattcatcctctcagcccaatttatgtgactctatcatgg
ccactggggttagggttcgggctaagatgcctgcattagtgatgtgcagaagtgcctgcc
accttgactatgcaggcaaggttggctgtggtccaagtttctctccttcacctcctcatt
EXON 7  80 bp
tttcatgagggcgaaaatcattctagtgaatccttcctctgtttggggttaaggagaatg
gatatgtccagctgacgtagctgttctgcttctcagagtcttagtgggaaatggggagat
tggggtggatggttggctacacaggcagaaagcataaaaccagatgtattttcctccaag
TGTACAAGACTGATCTGGAGAAGGACATTATTTCGGACACATCTGGTGACTTCCGCAAGC
TGATGGTTGCCCTGGCAAAG
gttggtttcccagtttctttctttgcccttgcttcctcccaaggcaagtcacatacctca
ttttatacttggagtgaattaactaaatcccctgtgcctgcatcagaaattcagctgcat
ttttgaaagtgggtttgcactgtcactgcagagttgtcaattttgtataataggatttct
EXON 8  60 bp
ctaggattacaggcgtgagccaccgtgcccggccccatctatgtttcaaagtaagaaaaa
tcttacgtggttacttatttaggaaattaaataatggcgtacatggactggggagaaaac
attttcagttttaaaatacacaaagaaatgtatttgaagttctttttctttcccccatag
GGTAGAAGAGCAGAGGATGGCTCTGTCATTGATTATGAACTGATTGACCAAGATGCTCGG

gtaagtgctgagctttttgctttgagtttttgttttctggtaagtctctggatagtctat
atagtaatttaactctgtgtgacaaatgactcccaaactctgtggcttaaaacaacaaac
atgtattatttctcagtttctgtgtgtcaggaattgaggagtagattagcccaattgttc
EXON 9  94 bp
gactgcttgtgattaagacttttgacctaaatagtaggtctctgcccatgtctgcagtat
aatcatctttcctcgtttggcattttgaatgtgtagctttttttgttttttttgcatgac
attttttttgacgttacattggatgtgtagttaacttttcctggttggttgtactcgtag
GATCTCTATGACGCTGGAGTGAAGAGGAAAGGAACTGATGTTCCCAAGTGGATCAGCATC
ATGACCGAGCGGAGCGTGCCCCACCTCCAGAAAG
gtgggcactgtgctgagggagtctcagtgccttggggccctggctggggcggctgggtgg
atgtccatgttgggatggagtctgccagaatgaggttctgtctccgcttggcactctcat
aggctcacccattttccctcacctttctctcccattctggattcttttctcttgcaaata
EXON 10  96 bp
ctgttccacgacaaacttggccaatgttggctctggtcaccgtggtaacctctaagctcc
taggatgctgtgatcatcctcaatttttaaaaaaattatggtgcataaaactaggtgggt
gatcgttgacagctttgactagtggctcggatctgataactctttgttgtttttcctcag
TATTTGATAGGTACAAGAGTTACAGCCCTTATGACATGTTGGAAAGCATCAGGAAAGAGG
TTAAAGGAGACCTGGAAAATGCTTTCCTGAACCTGG
gtaagtgaatgtggcccccattcctggtagacatcagctaccagagcagaagtgacagat
ggccatcctgttaatccaaatgtgtttgggaggtgtggcttctatgcatgctttggatag
ttttacagtcttaattgtatagatttcagaatataaaactgaagaaaggcctaacttggt
EXON 11  59 bp
gtggtggaacttagtattgcagaggatttctagatttcccttagcctgtcctattttgca
gcccttttccattgcattaggtcacttctggtttgtggcccagggccagggcatcctctc
tcattggtagaggagagaccagagcagctgcagcgctgactccctttcttctctccacag
TTCAGTGCATTCAGAACAAGCCCCTGTATTTTGCTGATCGGCTGTATGACTCCATGAAG
gtaagggcagctggctgagagagctgtgtttccacactcagcttttcttcttttgggtcc
caaattgagtctccttgattcatggatggaggaaggggaccccactgtgtggatgcagga
acacactagtcagctgtggttgtatgtgacagctgagagaaccacaaatctgtcttcttt
EXON 12  123 bp
gtttgtgttaagtgctgtatgtggaatttttcattgtggcatcatgtcggcactgaaaaa
gttttggattttggagcattttagatttcagattttcagatcagggatgctcaacctgta
gacgctttctttaacgataacattctcagcgaatgtaacaaatatcaacttgattttcag
GGCAAGGGGACGCGAGATAAGGTCCTGATCAGAATCATGGTCTCCCGCAGTGAAGTGGAC
ATGTTGAAAATTAGGTCTGAATTCAAGAGAAAGTACGGCAAGTCCCTGTACTATTATATC
CAG
gtaagcccgaggtgcagtgtcagcctgccctgccgtccagagcaccccgggccctggcag
gtggcctggcagaatgatgacagagtggcgattttctgttttctgactctctggggaaga
gatgctagtcatcaactatcagggatttattttgaaagcaccatttgtgatttgtcctgg
EXON 13  353 bp
gcttccctggcaatggtttgggtgtggccttccaggcctttgtatcagggcaggtctcct
gcagagtcttctctttgtcatgggagaagcttcattgtgcgttgaggctacttctgtgtt
attgaggagtctgggcttttttctgataccacgtttcttttctttcctgggccattgtag
CAAGACACTAAGGGCGACTACCAGAAAGCGCTGCTGTACCTGTGTGGTGGAGATGACTGA
AGCCCGACACGGCCTGAGCGTCCAGAAATGGTGCTCACCATGCTTCCAGCTAACAGGTCT
AGAAAACCAGCTTGCGAATAACAGTCCCCGTGGCCATCCCTGTGAGGGTGACGTTAGCAT
TACCCCCAACCTCATTTTAGTTGCCTAAGCATTGCCTGGCCTTCCTGTCTAGTCTCTCCT
GTAAGCCAAAGAAATGAACATTCCAAGGAGTTGGAAGTGAAGTCTATGATGTGAAACACT
TTGCCTCCTGTGTACTGTGTCATAAACAGATGAATAAACTGAATTTGTACTTT
agaaacacgtactttgtggccctgctttcaactgaattgtttgaaaattaaacgtgcttg
gggttcagctggtgaggctgtccctgtaggaagaaagctctgggactgagctgtacagta
tggttgcccctatccaagtgtcgctatttaagttaaatttaaatgaaataaaataaaata