Gene ADAMTS17 Variant 1
DNA : 367.66 KbNT_035325
mRNA : 3448 bp NM_139057
CDS : 3288 bp NP_620688
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  102 bp
gaggcggggcggaggaaagcgagggcccaatcccctcccgccttccgaggggaaggcggg
gcttggggtttaccacgttgggtttgtccgcagcgctaattactttttccaaaggctgga
gggcttcactccggctggcgccgccgcctagcgcgctcctgcttcgccgccacggtccgg
GGGGGCTGCCGGTCCCGGGTACCATGTGTGACGGCGCCCTGCTGCCTCCGCTCGTCCTGC
CCGTGCTGCTGCTGCTGGTTTGGGGACTGGACCCGGGCACAG
gtagcgccccctcccacagccctcttcaccccgcgtcctgcggctaccttccctctgcgt
tctcgcggcgtcctggcggcccgggggcggcggcgggaccgctgacggcgcccgagcgga
ggaggcgcgggccgcggccggagtacgggaatcgggtggctccgtggcaggcgcgccgcc
EXON 2  371 bp
ggctgcgccggagaccctccccgggtggcgcgggccagcgtggaggtgccgggcgaggga
agggaaggcagcgccggctccgggtcgcgctgtccccgcgctggcgcggctggcggccag
cgggagggcgggcgtccgggcgggccccgccgcgctgacgcgtctcctctctccccgcag
CTGTCGGCGACGCGGCGGCCGACGTGGAGGTGGTGCTCCCGTGGCGGGTGCGCCCCGACG
ACGTGCACCTGCCGCCGCTGCCCGCAGCCCCCGGGCCCCGACGGCGGCGACGCCCCCGCA
CGCCCCCAGCCGCCCCGCGCGCCCGGCCCGGAGAGCGCGCCCTGCTGCTGCACCTGCCGG
CCTTCGGGCGCGACCTGTACCTTCAGCTGCGCCGCGACCTGCGCTTCCTGTCCCGAGGCT
TCGAGGTGGAGGAGGCGGGCGCGGCCCGGCGCCGCGGCCGCCCCGCCGAGCTGTGCTTCT
ACTCGGGCCGTGTGCTCGGCCACCCCGGCTCCCTCGTCTCGCTCAGCGCCTGCGGCGCCG
CCGGCGGCCTG
gtactgcccgcgccacctccgggtcggcccgtccggtctgttgcgacgcagagtggtcgc
cgtggagggtgggggtggggcgcctctgctggaagtccagcctccaggggaaccggaggg
aaccccctgcctttccacctctccccatcccccaccccggccttcggtaccctctatagg
EXON 3  166 bp
ttgtaagtcacacacaagctcactcttgggctcaggtaaatctgaccaatctgcaaagaa
acgagcccagacctggaaaaccaaatcacagcaaggtggtcttgcctgcccctccggggg
gccatgggcgtgtgtgagtgaggatgaccgacatcgcgtttccttctcctttctggacag
GTTGGCCTCATTCAGCTTGGGCAGGAGCAGGTGCTAATCCAGCCCCTCAACAACTCCCAG
GGCCCATTCAGTGGACGAGAACATCTGATCAGGCGCAAATGGTCCTTGACCCCCAGCCCT
TCTGCTGAGGCCCAGAGACCTGAGCAGCTCTGCAAGGTTCTAACAG
gtgagtcggggcagcagcatgaccagcttagaacacacgcacagcccacatcctttgtgt
gtctccaagtgcactgaagccacatgagtgagaacttaccttcccctatatttcaaaagc
tgttttattgccctgagaccacttccttttcctttctatgtgtcttagtgtcggcagtcc
EXON 4  173 bp
ccccctacgtgagtgaactcggggcacccacatgacggtggagattgctgggtgctgggc
ccctctaggcctgtcgagactgaccactctctcgggcaggcttgacagaaggcctgttca
ctgcatggttttggaagtcagtaagccaaggaccgcacaaatgtttccatcattttctag
AAAAGAAGAAGCCGACGTGGGGCAGGCCTTCGCGGGACTGGCGGGAGCGGAGGAACGCTA
TCCGGCTCACCAGCGAGCACACGGTGGAGACCCTGGTGGTGGCCGACGCCGACATGGTGC
AGTACCACGGGGCCGAGGCCGCCCAGAGGTTCATCCTGACCGTCATGAACATG
gtgagtccggagccggggtcctgatgtggggggctctgttttctccttgatgagagatct
ggaagcaggtgctgtgtcctcatctcctcaagtgaggaagacgctgggttggggatacgg
gaacatagcctggtaattctgggcattgaggagggcaagtaactgggggacatcccgatg
EXON 5  84 bp
gtttcttgtaattaatgcaccaatactgatacagtgttataaactaaagtctacgcttta
tttctatttccttatttttacataatctcttttctgtgtcccaagttcccatctaggata
ctactgtatttttaaaattttttatctttatatctttatttcttttttctgtcttgatag
GTATACAATATGTTTCAGCACCAGAGCCTGGGGATTAAAATTAACATTCAAGTGACCAAG
CTTGTCCTGCTACGACAACGTCCC
gtaagtccccacaggcacctttcaagcaagcagaaaatgtggctgggctggagcttctca
actgctgttgaatgctaagcggggctccagggagttgccagtctccgtcactctctgtgg
ctttgccagcgtgagaggaaagccggcatcagtaccggaagcatggtgtgagggggggct
EXON 6  158 bp
tggtctctctggatctatgccacgtacccactagcatcaggcttttcttcgagggccgtg
agtcatcaaatgatgtctcagtgagtgactgcctccaccttaacgtccttgtcatagtct
ggaaataaactctggcctcccaggcgtttgtttctctaactgtcctctgactttttttag
GCTAAGTTGTCCATTGGGCACCATGGTGAGCGGTCCCTGGAGAGCTTCTGTCACTGGCAG
AACGAGGAGTATGGAGGAGCGCGATACCTCGGCAATAACCAGGTTCCCGGCGGGAAGGAC
GACCCGCCCCTGGTGGATGCTGCCGTGTTTGTGACCAG
gtaagatgggatttggcctgtagctgacatgtgagagggaaaagatgtttcccttcagag
aggaaataggcatgttgttaagaactcaggcttggaaatcagaccttgggccacctgtct
gggttttggtttcctcattagtaagtgggggttaacggtggtatccacctctgaggtagg
EXON 7  44 bp
cccgggaaatgtggatggattactgttgccaaacgctgctgtttgttatcattcgctgtg
gcctgtgtccactggaaaaataacattgcaggatgactacttgaggttaattcacagtgt
tttcttctcccattcttggggatactgcatatacctgatgatggcttttttattttttag
GACAGATTTCTGTGTACACAAGGATGAACCGTGTGACACTGTTG
gtaagtttagagttgaaataataatctaaggggctgatacaccctgggagaatctggaga
cttcctggtcacagtggaggagctgtcctcaaacaagcactgcacattctgttgccttcc
ttcctgtaagttggtctttgactttcctttttttattttcctgaaatgatttgaagttat
EXON 8  106 bp
tttattgggtgaacacaaaagcatcatacacaaacccttcccaggtgggctgaggctcat
agtcaccattgttgccgtgtgcctgccttgattgtgcatgacgttgaccgtgcggacttg
cccggtgagaccagggcctcccacgttctgaagaggatgtgttttgtgtctctgctgcag
GAATTGCTTACTTAGGAGGTGTGTGCAGTGCTAAGAGGAAGTGTGTGCTTGCCGAAGACA
ATGGTCTCAATTTGGCCTTTACCATCGCCCATGAGCTGGGCCACAA
gtaagtatcagactctgtgtcgtcctgttttctttcagtcctttttgagtgcagattttt
cacttgaattctgtaagttctaaaacagtgctgctctatgcctttgctgcatctgcaata
aaggacccaggtcagtacactagggtccaaaccctcagagaccccacgagatgactgcac
EXON 9  141 bp
tcctcaccctctatttctgtgaaaacacatgactgtgggtctgctgtgtgagaaccactt
tcacgttacgtccgtttttgtttttaagacttgatttaccttagcatggtccgctagcac
caggaactggaaatgagaagcttgtagcataagcatccctctctcctccttcttggacag
CTTGGGCATGAACCACGACGATGACCACTCATCTTGCGCTGGCAGGTCCCACATCATGTC
AGGAGAGTGGGTGAAAGGCCGGAACCCAAGTGACCTCTCTTGGTCCTCCTGCAGCCGAGA
TGACCTTGAAAACTTCCTCAA
gtaagtcctggaattattctataggatgaatgcaatcaaaagtacttccaaaagacaaaa
gtattggagtctcagcaagtgtgaagtggagaaatgactctcttttgggatttgcatcta
gcctcaggaggcggtcagcgcagagtgtcctataatggcaaggacatctcccacatgcgc
EXON 10  151 bp
aaaagaggaatgcacagcaaaaaagcgcagtctgtgtgtccagtgcctgcgtcctttttc
cataaggaacgtggaggtgccctcttctcagtgactgaaaactcaaaaaaaaaaagaaaa
agaaaacaaaaaaacctaggcagtacatttgcaagtcaacttgcctctcggctgtttcag
GTCAAAAGTCAGCACCTGCTTGCTAGTCACGGACCCCAGAAGCCAGCACACAGTACGCCT
CCCGCACAAGCTGCCGGGCATGCACTACAGTGCCAACGAGCAGTGCCAGATCCTGTTTGG
CATGAATGCCACCTTCTGCAGAAACATGGAG
gtaagcagccgtgggagggctggctcgggacagagcatggatccagccctcccacagcag
gtctggcttctgctggaggacatgggcattcacactcagcacaggcacatacacacacaa
gcacaggtatacatgtatatgcacacacacgtttgcatacagagacatgcataaacacac
EXON 11  102 bp
aaatgagccagttcaagtgatgcactgatattttggacatacagacttatgaccctctgg
cttccccatacgtttcgaatcccaaatttgaaacagtggttgggccacacctctgacccc
agctgtgacctgtgagtgtgggtgttctccacaattatggttccttcccttgtcctgcag
CATCTAATGTGTGCTGGACTGTGGTGCCTGGTAGAAGGAGACACATCCTGCAAGACCAAG
CTGGACCCTCCCCTGGATGGCACCGAGTGTGGGGCAGACAAG
gtaacctctgacttcccactgcccccaacaggcagctccacatcttgcaggcaactggca
cctcttctgacacacaatctgtactctacttaggagcccctgaaacatcccccaggcggc
acagaaatgcccatggaggccactccgggcacagagtggtgcctacatcacctcattcct
EXON 12  146 bp
cagtttgagtaagtaaggcatgtctctaaaattagcaaacgtgcaaaccctgaaatagac
tgtacctttatgtaaatttagcaaatgggtttttggcagcacggcattttggggcctggc
gggctggagtgagcagctctgctgagtgcctgggccccgaccctccccgctgtgtttcag
TGGTGCCGCGCGGGGGAGTGCGTGAGCAAGACGCCCATCCCGGAGCATGTGGACGGAGAC
TGGAGCCCGTGGGGCGCCTGGAGCATGTGCAGCCGAACATGTGGGACGGGAGCCCGCTTC
AGGCAGAGGAAATGTGACAACCCCCC
gtaagtcccctgaccagccataccccaacgtgccacgattggagtttcccaacagcagct
ctcgctgcctcacacaaagcagggtctgtctcccgctgagcattagaagatatggaaaat
gaaacccagccaaggtccagggtgcagggacctcgtgtgtgtcaaatgacatctcagctt
EXON 13  167 bp
acatgccggcagtgtgggtctgggattgtgggcatttggtctgtaacagcagagaggggg
tggctttggaaaccttgccctgcccccttcctctcctccccctggcaagagagacggaaa
cagctctcctgccctttggtcgcaccacctggttaacacagaccttcttcttccttctag
CCCTGGGCCTGGAGGCACACACTGCCCGGGTGCCAGTGTAGAACATGCGGTCTGCGAGAA
CCTGCCCTGCCCCAAGGGTCTGCCCAGCTTCCGGGACCAGCAGTGCCAGGCACACGACCG
GCTGAGCCCCAAGAAGAAAGGCCTGCTGACAGCCGTGGTGGTTGACG
gtaaaggcatatggcatgtccttgcatggcagcctcctgtcctcccctaagaatataaaa
accacctagggaagccggggggcatccctttcccaaaccaacccagcaagacactccagt
cctctgcccagctcagctgcggcccaactttgtaagttgtggggttgaccttgaatgacc
EXON 14  128 bp
cttcccctgtggctgtgggtctttttccgcttcctggagcgcgtacctgagctcatgcac
ctttactgacctgtgcggacctctcttcctcagggtttccctctgcccacatgtacctgt
gccctgcatggcccacgcacaccttcccgtgtcaacgtcctccaacctttccctcctcag
ATAAGCCATGTGAACTCTACTGCTCGCCCCTCGGGAAGGAGTCCCCACTGCTGGTGGCCG
ACAGGGTCCTGGACGGTACACCCTGCGGGCCCTACGAGACTGATCTCTGCGTGCACGGCA
AGTGCCAG
gtgacgtacttctccttcggtccttggtggggctttggagaggagactcactctccccag
acagggagtggggtagagcagaggtctcaggaggcctaggggagtggattttcttaggaa
ggcacccagtgatgccgcctcctgccgccagtgttgcctggtgcaccaaccctagctcag
EXON 15  121 bp
ttggattctgtgcatcttttttctctcctgaattaaaatattttcttgggcctctgaatg
gatcagggccccaggccccatgtatgctgcacctcatggaaaagttagccttgcagggca
gcctctttaaaactcctctgagtcttaaccacagaataatgaggccctctggttctttag
AAAATCGGCTGTGACGGCATCATCGGGTCTGCAGCCAAAGAGGACAGATGCGGGGTCTGC
AGCGGGGACGGCAAGACCTGCCACTTGGTGAAGGGCGACTTCAGCCACGCCCGGGGGACA
G
gtgagtgttggcccatggggctgctgtggctacagtgttttgtgtcctttgcctacagct
attgattgcagtcttccctacatttcatatttaagggctagatggtagtggataggtgac
ctggaacttcagtttcatttctgaaaagcaagaaaggacattttagcaagaatgatgcct
EXON 16  158 bp
gatccaggcttttgttctcagtatacagagcactcgccttctctcgcttcaggcctccct
ccttccccctgtggaagggagacctctgccccactcaggggctgtagattccgtttaaag
acaggctggatccccctacccccagccccttgattctttggtcttcaacttgctttctag
CTCTCAAAGACTCGGGTAAGGGGTCCATCAACAGTGACTGGAAGATAGAGCTCCCCGGAG
AGTTCCAGATTGCAGGCACAACTGTTCGCTATGTGAGAAGGGGGCTGTGGGAGAAGATCT
CTGCCAAGGGACCAACCAAACTACCGCTGCACTTGATG
gtaacttgctgggcttccacacttgtcttagggggtgtggctccgagaggtctactaggt
tactttccagtttacttctgcctgggacctcgggggcaggaaatgcatctggcttccagg
ggtttatgccgtcccctgctgctcagtcctctcccctctctgggtcctttcttttccagt
EXON 17  160 bp
cctgaggaatccagggctgagataaaggagcaccctcagtggaacctgttttcagcccca
gaaaagagctggttacccctcataaagaaacagccgcagtgtgcctgtgtgtgcagattc
ggcattcccacgggccttccttccttttcaaaatggccttttgttttgcggctgatccag
GTGTTGTTATTTCACGACCAAGATTATGGAATTCATTATGAATACACTGTTCCTGTAAAC
CGCACTGCGGAAAATCAAAGCGAACCAGAAAAACCGCAGGACTCTTTGTTCATCTGGACC
CACAGCGGCTGGGAAGGGTGCAGTGTGCAGTGCGGCGGAG
gtgagtggccgtggtccatgacctgttgggtgtggggttttgctgaaggaaggagaaagg
catctgtggccagcacgcagagtgtgagacatctgcaacctgtagctccatgggaattta
accatatcccaccgaaaatctctctgcagaatacttggacagagtcttcccaactcccac
EXON 18  136 bp
ctctcctccctacgattatagttcttcctctctaaaaacccacatgacatttacagcagt
cactttaaatgaccaagtgaccatcagcagcacccaaacatgctttcatgggcatgcaag
cccagcctttccacgtgggtgcagccacagtctctcagctccctgtggtttggtttccag
GGGAGCGCAGAACCATCGTCTCGTGTACACGGATTGTCAACAAGACCACAACTCTGGTGA
ACGACAGTGACTGCCCTCAAGCAAGCCGCCCAGAGCCCCAGGTCCGAAGGTGCAACTTGC
ACCCCTGCCAGTCACG
gtaagaagctgggttctgtagcttggacccaccagagtctggggcggcagcaccatcagt
ggtggggagtgatatgcagttaatgccacagtactgctctatgctgtgttccgttattgt
tgatgagagatttccgcttgctcaaattaccaaatttccagctactaagccaggactctg
EXON 19  205 bp
tcaagtcactccctctgtgccgatactctgagttatgtccagggttggctgaaaagcttc
ctgagtctgcctccctctctcccaccacagggcagcaattccaggatccggccggaaggc
cctccggagaggctggcctctcacccagtcgttctctctctctttcctcccgtctggcag
GTGGGTGGCAGGCCCGTGGAGCCCCTGCTCGGCGACCTGTGAGAAAGGCTTCCAGCACCG
GGAGGTGACCTGCGTGTACCAGCTGCAGAACGGCACACACGTCGCTACGCGGCCCCTCTA
CTGCCCGGGCCCCCGGCCGGCGGCAGTGCAGAGCTGTGAAGGCCAGGACTGCCTGTCCAT
CTGGGAGGCGTCTGAGTGGTCACAG
gtgggtgcctgggcttgccaccaggactcagccacagggactccaacacggtgccatggt
attggtgacattctggtgcctcccagccctcgctcgcccccaggtcagcttgaagttgtg
ttatagctcatgtgttcttaatttccatctcagataacagcctggctgcggaaacataga
EXON 20  153 bp
ccccagctgggaccacgtgcgtaagaccctgcagaccaggagctttttgaggacagaagt
gtgggttttcatctttgtatcatccccacaccgcacctggcacattggagggagttaata
gctgttgatggacttgaatcgaattggaactcggttaaatatttgaatggtgtcttgcag
TGCTCTGCCAGCTGTGGTAAAGGGGTGTGGAAACGGACCGTGGCGTGCACCAACTCACAA
GGGAAATGCGACGCATCCACGAGGCCGAGAGCCGAGGAGGCCTGCGAGGACTACTCAGGC
TGCTACGAGTGGAAAACTGGGGACTGGTCTACG
gtgagagcagcctgctggcatttctctccgtgccgcagtgcagggggctcgagggtcggg
aactcagctcttgtgacgggtcccaattctacgcggcagtcccagcgtaactaggcaaat
tcattttccttccacccgctgcaactacccaagaccccgtgtgcttcctcccctgcttct
EXON 21  178 bp
aggccccactcaggctgtcctgtctccgcagtgccacattgtgaggccatcatcccagcc
ccctgacctcgtgtaggcccccactcaggctgtcctgtctccgcagtgccacattgtgag
gccatcatcccagtcccttgacctcatgtcagccccactcaggctgtcctgtctctgcag
TGCTCGTCGACCTGCGGGAAGGGCCTGCAGTCCCGGGTGGTGCAGTGCATGCACAAGGTC
ACAGGGCGCCACGGCAGCGAGTGCCCCGCCCTCTCGAAGCCTGCCCCCTACAGACAGTGC
TACCAGGAGGTCTGCAACGACAGGATCAACGCCAACACCATCACCTCCCCCCGCCTTG
gtgagtgtcttcactggccccggttcccagggggctgctgtgtctcctgcccagtaagtc
ctccctgacggtgaggttctttcagccagaaagccccttcttgggcctcacttgtcacat
aaggctgacatttgtcagttctgtagaagaggtttcagagatggattccattccttgtta
EXON 22  298 bp
tgacagaaagtggcacccccagtgccctggcaggaggcatggcctaatcagtgcaaaggg
ttgacgtgtgcacgagggtgagggagcccagacggtcagaccacaagccctccctgtgcc
tgcatcaggacatgcctaggccatccctgaccctgggtattctctctcctatccccttag
CTGCTCTGACCTACAAATGCACACGAGACCAGTGGACGGTATATTGCCGGGTCATCCGAG
AAAAGAACCTCTGCCAGGACATGCGGTGGTACCAGCGCTGCTGCCAGACCTGCAGGGACT
TCTATGCAAACAAGATGCGCCAGCCACCGCCGAACTCGTGACACGCAGTCCCAAGGGTCG
CTCAAAGCTCAGACTCAGGTCTGAAACCCACCCACCCGCAAGCCTACCAGCCTTGTGGCC
ACGCCCCCACCCGGCTGCCACAAGAATCCAACTACATAGAACATGAGCGTGGACTTGG
cgtttgccattagtgcttccgtacttaatatattgttaacagccactggctggctttcta
cagtgaggagaaagtaggcatgagtcacaaagtaacttcaatttctaggatttcaggtac
ctcgaagggaagcacctctggcagacaaccgtcaagagagagacatcatttagtgttctt