--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (19751 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (15 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1202       1384   1   Internal    183   100   Excellent
cccgcacacacacacccgcacgccccccccgcacaccccacctccccccccgcacgcccc
acctaccccccgcacgccccaccacccgccgcacctcccagaaatgactgagaagccaca
agggatgcctgagcccaggggactgcaggtgggcgtgacctgtcccctcctctcccctag
TGGCAACCTTGCGGCTTGAGTCTGTCGACCTGCAGAGCTCCAGGAACAACAAGGAGCACC
ACACGCAGGAGATGGGCGTCAAGCGGCTCACTGTGCGCCGCGGCCAGCCCTTCTACCTCC
GGCTGAGCTTCAGCCGACCCTTCCAGTCCCAGAACGACCACATCACCTTTGTGGCTGAGA
CCG
gtgagtttgccctgtcccaaggccccgcaggttccgtcaaaatgagggcatttacagagt
ctgcctgcggggcccctgcctttcccacctgagctgccctccactttcttgtcctgggag
ccccagacccctcatgctcaggaccctgttagtgctgttaaggagagatttggtcaactc

Exon  2 +       1879       2124   1   Internal    246    69    Marginal
acagattaaaaaacggaggcctgggggtcttaaatggtttgcctgaggacactcggtggc
agtaaaagccaaaagcattagcaggtggtgggagaaggtgacggtccttccgactcccct
ggaatcatataccatacaggttttttgagcctcactgtggggtcattctctcctacacag
GACCCAAGCCGTCAGAGCTGCTGGGGACCCGAGCCACATTCTTCCTCACCCGGGTCCAGC
CCGGGAATGTCTGGAGCGCTTCTGATTTCACCATTGACTCCAACTCTCTCCAAGTTTCCC
TTTTCACACCAGCCAATGCAGTTATTGGCCATTACACTCTGAAAATAGAGATCTCTCAGG
GCCAAGGTCACAGTGTGACTTACCCGCTGGGAACTTTCATCCTACTTTTTAACCCTTGGA
GTCCAG
gtaggatgtgcccacagcttgtattgctaacctgatccattgggaaggccctgtgaggtt
ctttggaaaaagcccagaaaataaatcgccacatagctatgcaatgtagtagcgtgtgct
ctcacaaaaatcatctttacaaagaatttctaatggcatgaggaaagtattcatgacgtg

Exon  3 +       2736       2883   1   Internal    148   100   Excellent
tggcttctagaaaagcacatagtagacctttaagggggtctagtcttaatttctgttgct
atcaacccatcgactgttcctcctgttttccagaaacacgttgtcgttactgttttttaa
tttaatactctgtttttttggtttggggttttgccccctccactactcttaactgctcag
AGGACGACGTCTACCTGCCAAGTGAAATACTGCTGCAGGAGTATATCATGCGAGATTATG
GCTTTGTTTACAAGGGTCATGAAAGATTCATCACCTCCTGGCCCTGGAACTACGGGCAGG
TAACACTATTACCCAATGTGGGCCTGGG
gtgggctccctaaggctggtccttacacaaccctgttatgtaaggctgttatattacaca
gccctcatagagggccactaatacaggcgagggtgtgaggggcttggccagcttcacatc
cagtgagaggggcaaggaaggaaggggtggatgtctttcctttttagtttttaacatttt

Exon  4 +       3738       3991   1   Terminal    254    74        Good
ccttcatgctaaaaactctcaataaattaggtattgatgggacatatctcaaaataataa
gagctacctatgacaaacccacagccaatatcatactgaatgggcaaaaactggaagcat
tccctttgaaaactggcacaagacagggacgccctctctcaccactcctatttaacatag
TGTTGGAAGTTCTGGCCAGGGCAATCAGGCAGGAGAAGGAAATAAAGGGTATTCAATTAG
GAAAAGAGGAAGTCAAAGTGTCCCTGTTTGCAGATGACATGATTGTATATCTAGAAAACC
CCAACGTCTCAGCCCAAAATCTCCTTAAGCTGATAGACAACTTCAGCAATATCTCAGGAT
ACAAAATCAATGTGCAAAAATCACAAGCATTCTTATACACCAATAACAGACAAACAGAGT
CAAATCATGAGTGA
actcccattcacaattgcttcaaagagaataaaatacctatgaatccaacttacaaggga
catgaaggacctcttcaagaagaactacaaaccactgctcaatgaaataaaagaggatac
aaacaaatggaagaacattccatgctcatgggtaggaagaatcagtactgtgaaaatggc

Exon  5 +       4053       5663   0     Single   1611    92   Excellent
aaaatctccttaagctgatagacaacttcagcaatatctcaggatacaaaatcaatgtgc
aaaaatcacaagcattcttatacaccaataacagacaaacagagtcaaatcatgagtgaa
ctcccattcacaattgcttcaaagagaataaaatacctatgaatccaacttacaagggac
ATGAAGGACCTCTTCAAGAAGAACTACAAACCACTGCTCAATGAAATAAAAGAGGATACA
AACAAATGGAAGAACATTCCATGCTCATGGGTAGGAAGAATCAGTACTGTGAAAATGGCC
ATACTGCCCAAGGTAATTTATAGATTCAATGCCATCCCCATCAAGCTACCAATGACTTTC
TTCACAGAATTGGAAAAAGCTACTTTAAAGTTCATATGGAACCCAAAAAGAGCCTGCATT
GCCAAGTCAATCCTAAGCCAAAAGAACAAAGCTGGAGGCATCACGCTACCTGACTTCAAA
CTATACTACAAGGCTACAGTAACCAAAACAGCATGGTACTGGTACCAAAACAGAGATATA
GATCAATGGAACAGAACAGAGCCCTCAGAAAGAATGCTGCATATCTACAACCATCTGATC
TTTGACAAACCTGACAAAAACAAGAAATGGGGAAAGGATTCCCTATTTAATAAATGGTGC
TGGGAAAACTGGCTAGCCATATGTAGAAAGCTGAAATTGGACCCCTTCCTTACACCTTAT
ACAAAAATTAATTCAAGATGGATTAAAGACTTAAATGTTAGACCTGAAACCATAAAAACC
CTAGAAGAAAACCTAGGCAATACCATTCAGGACATAGGCATGGGCAAGGACTTCATGTCT
AAAACCCCAAAAGAAATGGCAACAAAAGCCAAAATCGACAAATGGGATCTAATTAAACTA
AAGAGCTTCTGCACAGCAAGAGAAACTACCATCAGAGTAAGCAGGCAACCTACAGAATGG
GAGAAAATTTTCACAACCTACTCATCTGATAAAGGGCTAATATCCAGAATCTACAATGAA
CTCAAACAAATTTACAAGAAAAAAACAAACAACCCCATCAAAAAGTGGGCGAAGGACATG
AACAGACACTTCTCAAAAGAAGACATTTATGCAGCCAAAAGACACATGAAAAAATGCTCA
TCATCACTGGCCATCAGAGAAATGCAAATCAAAACCACAATGAGATACCACCTCACACCA
GTTAGAATGGCGATCATTAAAAAGTCAGGAAACAACAAGTGCTGGAGAGGATGTGGAGAA
ATCGGAACACTTTTACACTGTTGGTGGGACTGTAAACTAGTTCAACCATTGTGGAAGTCA
GTGTGGCAATTCCTCAGGGATTTAGAACTAGAAATACCATTTGACCCAGCAATCTTATTA
CTGGGTAAATACCCAAAGGATTATAAATCATGCTGCTATAAAGACACATGCACACGTATG
TTTATTGCGGCACAATTCACAATAGCAAAGACTTGGAACCAACCCACATGTCCAACAATG
ATAGACTGGATTAAGAAAATGTGGCACATATACACCATGGAATACTATGCAGCCATAAAA
AATGATGAGTTCATGTCCTTTGTAGGGACATGGATGAAGCTGGAAACCATCATTCTCAGC
AAACTATCACAAGGACAAAAAAACCAAACACCACATGTCCTCACTCATAGGTGGGAATTG
AACAATGAGAACACATGGACACAGGAAGGGGAACATCACACACTGGGGCCTGTTGTGGGG
TTAGGGGAGTGGGGAGGGATAGCATTAGGAGATATACCTAATGTTAAATGA
cgagttaatgggtgcagcacaccaacatggcacatgtatacatatgtaactaacctgcac
gttgtgcacgtgtaccccaaaacttaaagtagaataaaaaaaaaaaagacagagacctta
tggcctgcaaaggctaaaatatttactatttggttttttacagaaaaagcttgtccttct

Exon  6 +       7183       7292   1   Internal    110    84        Good
ataagctcttcaaaggcaggaacttgtcttatatttagcgccctccccctgcccccacat
ccccatatacatgccatccccaaaagtctgttagtgacttaaagtttcagaagtctagac
atttgctcttctcttttttctcccttaaaatcacttggaagtttgaagaggacatcatag
ACATCTGCTTTGAGATCCTGAACAAGAGCCTGTATCACTTAAAGAACCCGGCCAAAGACT
GTTCCCAGCGGAACGACGTGGTGTATGTGTGCAGGGTGGTGAGTGCCATG
gtaaggatggatgcttcccgccgtctgaggacagtctgagcttccccgggagctgtggaa
acccacctgtctgtcctctgcagatcaacagcaacgatgacaatggcgtgctgcagggga
actggggcgaggactactccaaaggggtcagtcctctggagtggaagggcagtgtggcca

Exon  7 +       7376       7553   0   Internal    178   100   Excellent
gatcctgaacaagagcctgtatcacttaaagaacccggccaaagactgttcccagcggaa
cgacgtggtgtatgtgtgcagggtggtgagtgccatggtaaggatggatgcttcccgccg
tctgaggacagtctgagcttccccgggagctgtggaaacccacctgtctgtcctctgcag
ATCAACAGCAACGATGACAATGGCGTGCTGCAGGGGAACTGGGGCGAGGACTACTCCAAA
GGGGTCAGTCCTCTGGAGTGGAAGGGCAGTGTGGCCATCCTACAGCAGTGGTCAGCCAGG
GGCGGGCAGCCTGTGAAGTACGGACAGTGCTGGGTCTTCGCCTCTGTTATGTGCACCG
gtgagcgaaagatcactcacttaggggtgtgattaacttcattatcagagaagttaactg
tggctcataaaggttcagtagcttgcccatggccccacagctgggggtggtgggcaccca
ggccctgagctagcacaccatacagtctcgagggatcctgtgcatttatgtgagaggggg

Exon  8 +       9881      10019   1   Internal    139   100   Excellent
ctgatggggcagcagggctgtgggactgggtgtggggctctgggaataaaggagttactg
gtgtggttccgtaagcgtcttggctttctctcctccagcttgaaagttacaaattatgca
tggaaaaccaataattctgcctgaaatgaactcagcgattctctatatttttctctttag
TAATGAGATGCTTAGGTGTTCCAACCCGTGTTGTTTCCAATTTCCGTTCCGCGCACAACG
TGGATAGGAACTTGACCATCGATACGTACTATGACCGAAATGCCGAGATGCTGTCAACTC
AGAAACGAGACAAAATATG
gtgagaggcactgtcttgaacagatctctgctttgtcccagggagggcagaaaaactgac
ctggttctctctggctcttgaggaaatattgcaagattgccctgagcattgctgctaatg
ctcagagaagagaagaattccccaacccaggaggctgttctggctaattaggtcatcaaa

Exon  9 +      12213      12316   2   Internal    104   100   Excellent
gggattacaggcgtgagtcaccgcgcccagcctgtactattcttgtgacttttagtatga
aattacttcctaataaaaagtaagaaaaagaaacaatgatataaatcactccgtatagtg
cctggtacctggcaaaacctcagctaacatgaatccttgtctccttactccctcctgcag
GAACTTCCACGTCTGGAATGAGTGCTGGATGATCCGGAAAGATCTCCCACCAGGATACAA
CGGGTGGCAGGTTCTGGACCCCACTCCCCAGCAGACCAGCAGTG
gtgagtgaggaccattgcaacaggctctggctctgtggggaggcagattagggtgactgg
ccgtgggagcaggagaccagggaggagcagcgttttccacggcaccctcttcccgaggtc
ccagctgacacagcttcagatcaggaatctaactctaccattgacagagtcacccggatg

Exon 10 +      12747      12989   1   Internal    243    99   Excellent
ttgccacttcacagggtggctgtgagggtcagatgaattaatgggaacaaaagtgcttgg
taaactggaagatatcccacgggtgagagtcagtggtgccgctgcctatcccatctccac
ctcccacagccacaaccagctgcccctggcccccatatcagtagcctgttgcctccacag
GGCTGTTCTGCTGTGGCCCTGCCTCTGTGAAGGCCATCAGGGAAGGGGATGTCCACCTGG
CCTATGACACCCCTTTTGTGTATGCCGAGGTGAACGCCGATGAAGTCATTTGGCTCCTTG
GGGATGGCCAGGCCCAGGAAATCCTGGCCCACAACACCAGTTCCATCGGGAAGGAGATCA
GCACTAAGATGGTGGGGTCAGACCAGCGCCAGAGCATCACCAGCTCCTACAAGTACCCAG
AAG
gtgctgggcgggtatttggggaaagggctgctttaagcttctttgtgatgcttcctagct
gggatggctccaagttgaaaccatcaccatcgaatcacctcttcctcatggcaaactcct
aggggtccttcctggatcccaggcatgtggccctagggtagggttaccagcaaataaaaa

Exon 11 +      13678      13747   0    Initial     70    53    Marginal
gcctgtggatggggtggacacccccacggagggcgcatgtgtggagtcaggctgcctgag
tactgaacagggctctgccatgccctgtgtaagactggacacagtttaccacccctgtgc
ctccatttcctcatctgtaaaatgggataacagtccctcggacggctgttgagaggttaa
ATGAGTGTCCATAGAAAGCACTGGGAACAGTGCCTGTGGAATGCAGCAACTGCTCCAGAG
AAGTCCACAG
gtgggggtaagtttgggttaagctgttggaggcggcacaaatgtttcttatgattaggca
taactgaagcctgtcagtaacaatctgaacctgtgctcaattaagcagctgaccagtcat
tacctcctcctccttgctcttgctacccaaataaatatgaagggcggtagacactcagcg

Exon 12 +      14882      15389   1   Internal    508    81        Good
acagaacagaacactgagagattaaaggactgtgacagagcaaggatttgaacccagcaa
gcagcacctgagccgcgccgcctccctgtgctgctattcctgtgccttgttgccccagga
aagtcactggtcctctccacccctccccatgcatgtctctcctacctctcccttctgcag
GATCCCCTGAGGAGAGAGCTGTCTTCATGAAGGCTTCTCGGAAAATGCTGGGCCCCCAAA
GAGCTTCTTTGCCCTTCCTGGATCTCCTGGAGTCTGGGGGTCTTAGGGATCAGCCAGCGC
AGCTGCAGCTTCACCTGGCCAGGATACCCGAGTGGGGCCAGGACCTGCAGCTGCTGCTGC
GTATCCAGAGGGTGCCAGACAGCACCCACCCTCGGGGGCCCATCGGACTGGTGGTGCGCT
TCTGTGCACAGGCCCTGCTGCATGGGGGTGGTACCCAGAAGCCCTTCTGGAGGCACACAG
TGCGGATGAACCTGGACTTTGGGAAGGGTGAGTGTGAGGCAGGCCTGAGAAGGCACCTAC
AGGGAGGGGAGCTGTGGGTCCATGAACACAGTGGGGTGGGCCCAGCCAGATTACACACAG
ACCCCTTCCTCCAACACACACACATTCTGGGCAGTGAAGCTGCCAGCTGCTGCACCTCTG
ATGCCACCCCACCAGGCGAGACGGAGCA
gtgagccctggggacagtgtgtgcgtggtgggacgctgtctgtctgtctctcacacacac
ttttacctctcacgtgaaaattctaatttttcctctctcacatctacatgtcccccctct
ctctggtccatgtcctggactcaaggtgtcttttgtatgtgcttagagacacagtggccg

Exon 13 +      15587      15719   2   Internal    133    96   Excellent
tgtgtgcgtggtgggacgctgtctgtctgtctctcacacacacttttacctctcacgtga
aaattctaatttttcctctctcacatctacatgtcccccctctctctggtccatgtcctg
gactcaaggtgtcttttgtatgtgcttagagacacagtggccgctcctcctgccctacag
CAATTACAGAAACAAGCTAACGGACGAAAAGCTCATCCGCGTGTCTGGCATCGCGGAGGT
TGAAGAGACAGGGAGGTCCATGCTGGTCCTAAAAGATATCTGTCTGGAGCCTCCCCACTT
GTCTATTGAGGTA
gtgtctggacatgggtgggggctctgaggctctctgactcacccaatccaggggctgggg
tgcagcagccaacaagacactgttcccacctctcaccacaccgatggctccagcacagta
tggtgtggtctagtgctctgtaccagcgtggggttggaggggcatgaaggcttctcaaag

Exon 14 +      17838      17971   0   Internal    134   100   Excellent
ggcctgtatatgtgttaatctcaagtactctcagctcacattcctccctcgccactgtgg
cacattagctctaagccgcagttcctggtggtcgccagggacctgggggtgggggtaact
gaaccagagtgcagaagcgaggccagttgcccatgggattgctgacttctctccacacag
GTGTCTGAGAGGGCTGAGGTGGGCAAGGCGCTGAGAGTCCATGTCACCCTCACCAACACC
TTAATGGTGGCTCTGAGCAGCTGCACGATGGTGCTGGAAGGAAGCGGCCTCATCAATGGG
CAGATAGCAAAGGA
gtaagtgacgcttctgcccacctcccccttgctggtctcaggaaaggggtgccccatggc
gtcacaggaccctcctcagtctcctgtgcagtgcctctctgcccccactttctcaccctc
ctcaggaaaggctgagctcagtggtggtggtgagtgggagcctcttacccacccagaggg

Exon 15 +      18301      18378   0   Terminal     78    68    Marginal
gtgagtgggagcctcttacccacccagaggggaaccagatcacccctgccgccagcagga
agtcctcgaggctctcacaggctgtttctgactttcagccttgggactctggtggccgga
cacaccctccaaattcaactggacctctacccgaccaaagctggaccccgccagctccag
GTTCTCATCAGCAGCAACGAGGTCAAGGAGATCAAAGGCTACAAGGACATCTTCGTCACT
GTGGCTGGGGCTCCCTGA
gacccgccctccagctgccctccctggcacccctgccccacctggctcctttctactcct
ggctatgtcgtcttggctccacctctgtcctctctctagcctgcctgggaatgaatgaag
ctctgttagaaacaccgtgtgctttgggaagagacaataaagatgtctttatttatcacc

--------------------------------------------------------------------------------